Description :
From Genome Similarity Track
Location :
Scaffold_113:37565- 40198
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_14083adhesin-like protein

Sequence
2633 bases(100 bases per row)
GGCGCCTTGTATGCAGTTGGCGCGCACCTCTCGTTGCAAGGCGTGGTGATGACGGCCAACCTCGCCAACGTCACTGGCGGCGCCATCGCTCTCTTCAACT
CGTCGGGTGCTGCTTCAACCTGCGCCTTCTCCAGCAACACGGCCAGAGGTCATGGTGGAGCCATCGCGCTAAGCGCCGCCTCCCGCTTTGTACTAACGAC
GACGCACTTGACGGCCAACGCCGGCTCCAACGGCGGTGCCGTCGCCGTCTCCGGCGTCTCGACGTTGACGCTGGTCAACTGCAGCGTCTTTGGCGGAGAG
TTGAGCAGTTTTCATGGCGGCCTCGTCCATGCAGATGCATCGACCGTCGTCTTTGAAGGGTCGACACGCCTCGCAAACGGTGCGGCCACTCGCGGCGGGG
CCTTGTATCTGGCCAACGCGGCCCGTTTGTATGGTCATGCCGTTCACATTGCATTCAACGTTGCGTCTCGCGACGGCGGTGGCATTTTTGCTACCGGAAA
CGCCACACGCGTGCAGCTGCAATCCGCGCTGATCGACACCAACCGTACGCTTCATGTGTGTGCATCGCTTCAATTGTGTACACAATTAGGCGCGGGAGTT
TGCGGCGGCGGCGTCTACGTTGATGCCGGCGCCTCGTTTCTCATGTCTGCCAACTCGAGTATCCAAAACAGCGTCGCGCGAATGCACGGCGGCGGCATCT
ATCTCCACGGCGCGTTGGCCAGCGCGGCCGAGCTCTACGATTCGAGTGTCGTTAGGAACGACGCGACGGGGCACGGTGGCGGTACGCACCTTCTTCGTCT
TTCGTTGCACGGCCCTGACGGTTTACAGGTATCTTTGTGGGTCACGGGGGCCAGCTCGTTCTGATTGGCACAACTGTGCGACGCAATCGCGGGCGGCGCG
GCGGCGGTCTCTTTGCGACCACCGCCAGCGTGACCTGCGTCCACGCCATGTTTGCAAGCAACAGCGCCAACACGGGTGGCGCCATTTTCGTAGATCGCTC
GAGCTCGCTGCACAGCCTCGCATCCGACTTTTCGCACAACCTCGCCGAGACGAACGGGGGCGCGCTCGTTTTCGCAGCAAGAAGTGTTGGTATCGTCGTC
AACTGTACACTTAAGACCAACGTAGCCGCCTCTGGCAACGGCGGCGCCATCGTGCTCGAGAGTGCAGCACACGTCACGCTGCGTCAGTGCGTCGCCACCG
ACAACACGTCGCCACGCGGCATGGGCGGGGGGCTCTGTGCCACCAACGGTGCACGCGTCAGCGATACCGGGTCGCTTTGGACTTTGAACGCTGCGAGAGA
CGGTGCAGCGATCGCGCTCGTGTCGCCGGGGCCCCACGAAAGCATCAATGCCACGCTCTTGAGGAACGCGGCTCGGCGCCAAGGCGGCGGTCTCTACTTG
GACCATGGTGCGGAAGTGTCGACGTTTACCTCGCTCGTTTTGCGCAACAACTCGGCGTCGTCGGGCGGCGGTGTCTTTTGGGTGTTGGAGCATCCGTCGT
CCGGAGCCCACTTTTTCTGCGACAATTGCACCTTGGACAAGAATGCGCCGACGGACGTCGCGACGTCGGCTGTGTCGGTGGGGCTAAACGCGTGGCCGTC
GTCGTTTTTGAGTGGCGTACCGCTCACGGTCGGCGGCAACGCATCGGCGTACGAGGCGTCGGTGCTTCGGCGATCGCCGTTTTCGTGGGCGACGGTACAC
ACCACCGATTACTACGGACATCGAGCTGGCCTCGACAACGCGACGACGTGTACGTTTTCCGCGTCGGCGGCGGGTCTCGCGCTGTCGTCGACGCACGCAA
TCACGTACACCGCTGTCAACGGCCTCGTCGCCTTTGCAAGTGCCGCCATTCAAGGACCTATCGTCGCGCATCCCGTGCCCGTCTCGGTCGTGGTCGAATG
CAGTCGTTTCGGTGCGCAAATGGTGCCTCTGCAAATCGCCATGGTCCTCACACCGTGTGCACCGGGGTACTCGACCGACCCCGCAGGGTACGCATTGTAC
GTGACATGTCTATGGAGTTTAGCCATTGCATTAGGCGATGTGTCCGGTGTCCGTCGGGGCAATATAGCTTGAACGGCACAACGTGCTTCAACTGTCCTCC
CGGGGCGATCTGCTCCGAGTACATTCTGACAACGGGCGCGCCCGCACTTGTTGGTGTTGCCCATCCGCGCACACTGCCCAACTACTACCTTGACCGCGCG
CCGGCGAGGCACCGAGAAACGCAGTGTGATCCATTGAGTTGGCCGTTGACAGACCCGTGCCGGGCGTTTGCCCTTGCGTCGAACGACATGGAAGCCGCGT
TGACGCAGTGCTTGACGAGTGTCGTGCCGGCGACGTACGTGGCGTCCTGGCCGCCGATGCGGGAGTTCATGTGTCTCTCTGGCCTCGCGTTCTACCCGTG
TCAGGTTGTGTCCTTCTTGCTCCTTTCATTCTCATGTTGAAGGGTCTTAGGTCGAGAACGTCTGCCTTGGCAACATCGACAGTCTACTCGGTCATGCGTG
CGCCCTTGGCTACGCCGGCTCGTTGTGCGGGCGTTGTGCGTCGGGGTACTCCAACTCGATCTCTGGCACTTGTCAATGTAAGACTTTCTTGTCGCTCAAA
GTGCAAGTGGAGACTCGGTGGCACTAGACTGCA