Description :
From Genome Similarity Track
Location :
Scaffold_61:37562- 41488
Transcript NameFunction/comments
Physo_138173reverse transcriptase

Sequence
3926 bases(100 bases per row)
CACTTCCTCGACCTTGGTGTAAGGTACACCAATGGCTACATACATTTACGACCACCACGACGGGTGATCCATACACATTTAGGATTCCTATTGACTGAAA
GCAGCATCTTTTAGCCAATGAGTGACTTGTATGTTAGCAGAATCCTGCCAACCAGCCGTTGGCAGATTCCTAGTTTAGAATATTACATTTAGAGGAAGTC
AGAAACATAAAACAAAAATAGCAGTTCTCATCTTTTACCAAAACCCGCTACTTGTAGTCTTTATCTTGTTTAAAGTATACTCGTGGATCTCGAGTATACT
TAACTTAAGTAGAAGAAACCTACATACACGTGCGCATACGTGTAAGCCGTAGTAGTGAGCCAAGGTAGGCCCATTACACCTGGTAGCGCTTTGTAGTCCG
TCCAACGACCGACTACCTCAACGTTCATACGGAGCTGTACGAACGACGAGCCGAGAACCTTTTCATGAGCGCGGAAGTGCTCATGCAAAGCTCCACTTCG
CCTGCAACTCATGTTGCACGCACTGACTGCCTCCACCTGTCGGACCCAAAGTGGGAGGCACTCCAAACACTGTCAACAGTCATTGGAGAAGCGGCTGTAG
CTGCAACGCTGGGCACACTATCGCCGACGGAGCAACACGGCGTTGCTCTGGGATTCATCATGAAGGAGCAGCGTGATGCTGCTTCCTCTATCACGGTGGC
GTCGAGGACGGCACCGCGTGAGCAATCGTTGAAGTTTAACGTGACCAACTATGTCAGATGAAAGGGCGAGCCTCTCCTCCGGTGGCTTGTCGACCTCAAC
ACTGCTATTGCGGCTCGACGTATCGTCGACCCGTTGTCCAAGGTTGCGTACGCCATGTCATGTCTTGGCGGACGAGCGAGAAGTTGGGCGTATGGACGCC
GACTCTCGGATCCTACGTGCTTTAGCACGTACGAGGGGTTCACGGTAGAGCTCAGACAAGCATTTGAGCCCCCGCAAAACGAGTTCCGGTCGAGGGCAGA
GTTCCTCGACCTACAGCAGGGTAAGCATGATATTCATGCTTACGCGAAGAGAGCACGGTACTTGGTCTCGAACATTGTGACCAACCCGATAGACGAGGCG
ACCAAGGTCGTCACGTTCATGAAAGGACTTAGAGATGGGCCTGTGAAGTCCTATCTCTTCCGTGAGTATCCGAGTACTCTCGAAGCTGCAAATACTCTTG
CAATGCAGGAGGAGTTTAGCCTGCGACAGGCTAAGCTGCATGCGAATGCGCCGAGGCTGTGACCGCCTCCGGTTGCGATAGCGGGAGGTCCGAAACCAAT
GGACCTCTCGAATCCAACGGCTATTGATTATAAACAGCAACAAGGAAGTAATGTACGATGCTTCCGTTGCACCAAGATGGTGGTCGACGCGGCGATGCCG
GACATCGTCGCGGACAAACAGAAAACGCTGGAATCCAGTAGGCGCGGGGCGCCCTACTGGTGAAGCAGTAACGCGTGTCCAACTCGGACATGCGACACTG
AGGACTGCAGCCCCCAGGGAGGACCCTTCTCACTGCAAAATGCACGATGACAAACCGAGCCTTGTCATCTTGAAAGTGTCTTCGAAGAGAGAGAGAGCAA
CTCTCTTCGTGCTTTGGTTGATTCGGGCGCGTCGAACAACTTTGTTCGACTGCGAAGTCTATCAAGGCTTGACTTCGAGGAGGTAATTATACCTCGAAGT
ATGTTGGAAGTTCGATTGGCAACGAGTGCCATCGTTAAAACCGAGAAGCGCATGGTACGCGTGCGCTGTATTGGGCGCCGTCGCTTGCACGGCATGATGC
GGTCATCGATTGGGAGAAGCGCACTCTCGTGCGCTGTGGGCGCGACAGCGGAACACTGAGCGATGGCCTTGTTGCCACTACGCACGCACGGACAGGTGCG
CGCGACTCCCCACTCGAGACAGCGCCTAATGCCTGCTGTCCCGGAGCGCCCTGGGCGCGTGCGAGCACGTGCGCAAGAGCAGCAATCGTCGGCGTCCTCG
CCGACGGCTTAAGGAGAAACTGTGTTGATCTCGGAGATCGACACCCGATTTTCAGCGAATCAGAATACGTCTCCAACCTCAAGGGGCGTGGGTGACGCAC
ATGTGTCACATATGTCAGTCCCCACGACTGACATGGATCTGATTTTGGGGGTGTCTCCAGTCCGAAGGGACGCGGATGACGTAAACATTTTTCATATTTC
AGCCAGGGAGGCTGAAGCATGGATTGAGGGAAATCTGATTGGATCAGGTTCGAAGGTGTCACCGACCTTAAGGGGGAAGGGTGACGATGCTCAGACGACT
CGGGGAGTCGACGAGCCAATCATATCGACTCAAGGAGCCGACGCACCCTCCGTAATGGGGGTCTTCGCCAATGGTTGGCGTCGAGGTACTAGGGCTCCGC
CAATAGCAGGCGTCGAGGTGACGATGGCGTGTCGGCTCCGGGAGCCGACCCTGTAGGCGGTTCGGACGGTTGCAAACGTCCCGCACCGGAAAACTTGCAT
GCTGTCGTGCAGTCGGGCTGCACAACGAAGAGCCGGGCGACTAAACCGTGCTTGAAGTCGCTCGTCTGCGGGATGAACCCGCCGGCGGTACTGAAGAAAA
ACGCCCGCCCACGGCTGGGCCTGGACGAGGTCAAGAACCAAGCGGAGCCGGGCTCCGCAAAACAAGAAGACGGCGCATGCGAAAGTCGCTGCGCAAGTCT
CGGCCTGGGGCCGAGAAGCTACAATAAATGTCTGCCGGGCAGATGGAGGCTGAGAAGCCGGACATCGAGGCGTTGAACGTTTTGACGCGTACCTGTACCG
GGTTCCGGTACAGGGAGATGACTCTCGCTAATCCTCCGACGCAAGCGTCGGAGTTGACTTCGCATCCAGTCATGAGCTGGAAACGCTTCGCGCGTGACTT
GCACGATGGACGCATCGAGCAAATATACATTCTCTCGGACATCGAGAGAACGAAGAGCGAGAATGGAGAACTGAGACAGTTCTTCATGGAGACCACCACT
GAGAGTGAGGCCACTCTCAGTGCGAATACTAAGAAGGAGCGCGTTGAGGAGCAGAGCTGGGACTCGCTGAAGTCGAGTCCCTTCTACGAGATTCTACGGG
AGCCCGCGGACGTGCTTCCGGAAGAGATCCCTGCGGAGCTTCCGCAGGACAAGGGCATCCATCACGAGATTGATCTCGTGCCGGGTACGAAGTACTGTGT
CACGCGGCAGTGGCCACTGCCGCAAGAGCAGGTCGAAGCGATCGACGACTTCTTCGAAAGTCGTCGCAAAGCTGGACAGGTGCCGGAATCGAAGTCCCCG
CACAGTGCCCCGACGTTCTGTGTCAAGAAGCCACAGGGCGGATGGCGCATCGTACAACAATCTGAACGATGCGATGATACCGGCGCAGACACCGATACCG
CGAAAATATGTCATCATCGATTAGATGGTCAGGAGCACTATCTACAGTGCTCTTGATCTGCGCGATAGGTTCTATCGGATCCACATGCGTGAGAGCGATA
TCCCTCTTACGGCCGTGAGCACGCCGAGCGGCATGCTCTGGGACTGGCTAGTGATGCCACAGGGTCTAAATAACGCCCCTGCGACCTTCAACAGGTGCGT
GACACACTTGTTGCGCTAGGTGCGCGACTTCGCACCGAGCTACTTCGACGATGTGTTCGTCCACAGCCGGGCTGCGGACGGGATGAGCGATGTTGAGATG
CACAAGGTGCATCTCCGGAAGCTGCTTGCGCTCATGCGCAAGCACAAGCTCTATGCGAACCTGAAGAAGTGCATCTTCAGGACGAGCGAGATACATGTGC
TCAGGTGTCTCGTTGGGAAGAACGGTGTCCGCCCTGACCCTGAGATGGTCAGAGTAATCAATGAGTGGCCGACGCCGTCGAACGTCAAGGAACTGCGGCA
GTTCCTTGGCTTGGCCACGTACTTAT