Description :
From Genome Similarity Track
Location :
scaffold_805:3755- 4824
Transcript NameFunction/comments
Pl_102341hypothetical protein PHYSODRAFT_525160

Sequence
1069 bases(100 bases per row)
CAAGAACGGGTGTTGTAATAGACCCTCGTCTCCATCAATTGGCGGTCGGAGGCGATGATCTCGCTGCAAGCAGGAGCGAATTACGTCTTCCAGATCTTTG
TTCTGCAGCGGTGGAAAATTGATTGGCACTGACGGGTCGATAATGCATCGGAACTTCTCGATGATGCTGTGCACGTGTCCGAACGGGGGCTTCGAATACA
CAATCTGATAGAGAATACACCCGAGTGACCAAATATCGCTTGCGCGCCCAACCTACCATTAAAAAATCGCACGGGTATGGGCGTAAGCCTTAGTTTTCGT
CAGTTTTCCATTGCTCAGACATACCTTCATTTTTCCTGCAGGATCACGCTGACCATTAGGCGCCGTGTTGCCTTGAATTGCCTCTGGGGACATAAAATTG
ACTGTTCCGATTTGGCTGTCCCTCTCGATGTTTGTCGTGTCATTCGAGATTGTCTTAGCGATTCCGAAGTCAATCAGTTTGAGGGTGCCATTTACAAACA
AGAAGTTTGCCGGTTTTAAATCACCTAGGCAATTCACGTGACATACCACATGTCAGAAACTGAGCGCACACGATCCCTAAATCATATCACCACGATATCC
ACCATAGCTACGCTCGTACCATGAATAATTCGTTTTTGGTGAATAGCATCCACAGCTTGAAGCATTTGTGTCCAAATTACTCGCAACATATTCTCATCCA
TGTCGCCCTTCAAATCGTTGAGTCGATCGCTCAGATCGATCTCGCCGTGCTCCATAATCTAACACACGGAGGCATAAAAATAAGTACGATAGTTGTGCAT
ATTTCATAAATGTCATGCAAACACATACCACATTGATCTGCCGCTGCTGAAGATCCTGCTCAGCAGCAATAAGCTTGATGATGTGTGGATTTCCTTGCAA
CTTTTTCAGCAGGTCAATCTCGTTTGTATACTGAGCAATACTTTGCGCGTCGAGCTTTTTCAACTTGATCTTCTTCAGTGCGTAAATTTTGAGATCTGGC
CCCAGCATACGGTAGACTTTGCTGCTCCCACCACTACCAATCTGTTCCAGCTTGATATACCGCTGTCCT