Description :
From Genome Similarity Track
Location :
scaffold_83:3754- 12344
Transcript NameFunction/comments
Pl_110173hypothetical protein PHYSODRAFT_553034
Pl_110174hypothetical protein PHYSODRAFT_323413
Pl_110175hypothetical protein PHYSODRAFT_477622
Pl_110176cyclic AMP-dependent protein kinase-like protein regulatory subunit

Sequence
8590 bases(100 bases per row)
CCATGCCATCAGAGCCTCATCGTGCTTCAAAAAAGGCTATAATATTGCACCACAGACCCACGAGGTCAACGGCCTCTGATGCAGGTCCAGTATCTGAAGA
TGATGCACATCGGGGAACCAGACAATCAAAAGGTTTACGACTTTTATGGAAACGAAGGCGAACAGTGACACCAGCAGCATTTCGTTCGTTCATTGTGGCG
GAGCAGCAGTCAACCATCAATACAAACGTGCCAGCGACAACACAACGTGTGGATAACGACCCCAATGAAAACATCGTCTTTCTCAACAATTCGGTGGAAT
TTGACCTGCGCTCGTATTTTTTCAAAAAGCAGAAATCGGGTCGCACTACTGATAGACTCGAGAGATCGGCTATTAGCCAAAGCTCAGTTAACAGTCATCG
CAGACACACACACGGGTATACTTCCTCCGACAACTCGTACAAACGAGAAACCATTGGAACAAAATCTGAAGTCGTGGATCCCTCAGACGTTTTGGCTGCG
AAACAATCGAACAAATCGCGACGAAGGTTACGCGCGAAGGAAGAGTTATGCATCGTATTACCAAGATCGACAGCTCGAGGACGGACTCGATCCCAGAAAT
CTTGGTTTCTTGGGCCAGGATTTATTGGGCGCGAACCTGGAGAAGGAACGCTCGTAGTCACAAAGGACAAGTCCATGGATGTTGTCCACGCTGAAATATC
CGTAGCTGGCGATGACTATTTCGTACGCGATGCTCAGAGCATGATGGGTTCTTTCCTTTGCTTGAGTACGCGCTATCGGCATTATCCGCAGCGTGACGGT
TTCCGCTTACGTAATGGAGATGTATTTCGCATTGGACCAGCTACTTCCCTTCGCGTTGTTGAGTTACAAACCAGCACTGAGGTGACTTCCATCCAAAACA
CACGAAGTGCCTTGTCTCGCTCCAATTCAAGTTCCAGCTTGATAGCAATGACTCCAGAACCGGCTGCATCAAAAGCCGAGATCAATAATTCTCAGGCCTC
TGAACTTGATAAAACTTCAAGCTCTAGCAATGCACCCTCGCTGAAACGGATGTCCACTGTAGAGGAACTTCGACTTCTCGCAGCAGATATCGAAGATGAA
CTCATGAACGACGATGGTAGAAGCCATTTAAAGCCTACACCACGATGTGAAGCCAATACTGACACTAAAACACCTCAACCCAGCTCATCGGCACGATTAC
AGCCGCGACAAACCGTTCATTTCTCTGATACCCCTCCTCTGATGTCGGACGGATCCGTGTTTTTGGGTAGCCGGTATATCCGCTCGGAGGTCAAAGACCT
CCACTATCGCGAGCCCTCTCAGGTAGAAGATGCCGATGATGATATGATCAAACAACTTGTTGGAAGTGAACATGACGTGTCTCCAACAGACTACTCAAAT
TGTTCACATATCAAAGTCCGACGGCCTGCATTCATTCGGCTCGTAATTTTTCAGCACGACTCCACTAAAGCTAGCATTGAGCCTCCAAACATTCGTGATA
CTCGTGAAGTGACTCTATCTGGACAAACGACTTTCCTCATAGGGTCTTCAGCAGCTTGCGATGTTCGCATTTTTCCATCCGAGGGCATCGAAATCCGTGC
TGTCCACGCTCGGATATTCCTTGATGGGTCATCTTTTGTACTGGAAGATGTATCTTTTGAAAATGACCCACGTCGACAAACTCGAGTCTTGATCGCTCAG
AGACCTGTGCGAGTTACTCGTGGCGATTGGTTGCTGCTTGGTAAGTGCGCCTTGTACATTACAACAGCACCAAGAGCTTTCGGTTTAGACCGCCGTCCTG
ATATGAAGGAGGCGGCCATGCGCTTAGACGTCTTGCGGTTGTCAAAACGAAAACCGAGAACCCGGGGCTTGTTTGTGCCTGTAGGTTTCCGATTGCACTC
TTCCTCGGGTTCTGGAGCATCTAGTGGTGGCAGTACCTGGGGTGGCAGCAGTGGTGGACCAGTCACATTTGGCAAAGGCCGAGACTGCGACGCACAAGTT
TTTACAGCATCGCTAGCAACCGAACAGTTCAGTGTACAACTTGAACGCGGAACGTGCTGGCTCACACCGAAGCCAACAGGTATCAACGCCGGAACATATT
TTCTTATCGGTCGCGATGAAGTTGGGCCACTATTCCTTAATACTGCCGCTGATAACGCTGAAGAATCGAAACGAGTAGAGGTAGTCAAGCATACCAGCAA
GCCTCTGCTGCTCTCAGAAGGGTGCGTTTTCCGTTGTGGTGGGTGTGAGCTGGAGGTCATGTACTCGAAAAGTGCAAATGCACCCGACGCGAAAAGCATT
GCTTTTCTTGAAGAACAAGAACACATTCAGTTCTTATGTGCCATGCCATGGTTACAGCCCATCGCAAGCGACTTGAAAACAATCACTAATATAGCGAGAT
GTGGTCAGAGGCTGAAGCTGGGAGTCGGTGACTTGATCTACGCGAAAGGCGATGCTACCAACTTTGTGTTCATCGTAATCAGCGGTGAGGTATCACTTCA
TATCGCCATGCCGAATGGTGGTCACAACAGGGACGATCAGATGGTGGAGAAAATAGTTGCTGGAGGATTCTTTGGAGAGATAAGCTTGCTTGATCCGTTC
GAGCCGTGTGCTTCACCGCCAAACTGTGATGATCTTGAACATTTAGAAACGGCAAAAGCTGCAAGTGCTTGTGAGCTTCTAGCGATTGCTCGAGAAGATA
TATGTGGGTATCTGAAGCTGTATATGGACATAATACGCGCTCACTTGCGGCATGATCGCTGCCGAGACAGGATCATTCGGATAGCAAGCAGTTGTGTGCC
ATGGTTACAAGGGATTTCACTGCAGGAAATGCGAATGCTGTCATCCCACGCAGAACTTGTTGTGTATCCTGCAGGATCCAACTTGTTTGAAGATGGGAAG
CTCTTCGTGCCTGCAACTTTCTCTGGTGGCAACACATTTCAGCTTCGTGATCGCGATGGCCTCCTTGTGCTCAGACGCGGGGATGTACAGGTCGTCAGGA
GCAAGAACGAAATACATCATCGACGCACGAGGAAGATGTATCATGAAGAAGATCTCGAAAATGAGCGACAAACGGTTAGAAGTGTTAATGACATCGGCGA
CGAATCTGACGAGGAGCCGGACGAATGGTGGAGTCCCATGGAACCAGTAATTGCGATGAGCTCAAACCCGTCCCCATCAGTCTTGAGTTTTTGTGACTTA
TCATTCCGACTGGAGGCAAAATCGACGACTGAGTGTTATTTTGTAGCCGCAGTTCATCTTGCTCACTTTTACGAAGGTATGGTAACTAATCATCAGCAAA
CTCCTCGTTCGGAGTACGATCCAGGCGGAGTAGCCGAAACTCAGCCTCCATTAAAGCGAGGCAACTCGCAAGTAGTGACCAGCGCATTGCACAACGAAGA
TTTCAAAGGTGATGACGATAACCACAATGCGTTGGATGGATCCGATGGGGAAGGGGATACCACAGCAGTCCATAGGTGGAGGCGAAAAAAACGCAATAAA
CATCTTCTGGAGCAAACTGTGCAGCAAACTAAAACCGATGTCCAAATACCAAACGCATTGGTGATGTATGTTCTCGCGGGGGCACAACGAGGTGATATCC
ACGTAGTTCGCAACGTAGCATCAATCGGTGGGCTTCTAAGCGGAGCCGATATAGAGCTTAATGACCGATACGTTTCATCCACACACGCTATCATCGAATA
CCATGACGGAAGGTACTGGCTTTACGATAACGGGAGCAAATGGGGTACTTTTGTACGTCTAGAGCAAGATAACGCCGTCGATATCAATCCTGGAGATGTC
TTTTTGGCCGGCGAAGTTGAATTCACTTGTCTTGCTTCATACCCGGAGCGGAACAAGCCTAGTATGTGCTGTATAATGTAAGTTAGGTAGATTTTAAAAT
AATAAGCCATATTCCAACTGGGACAAACCGTGACATATTTCTCCTTATTCAATAGTCTTACGAGGAGATGCGGGCGAGGCAACCAGCACGTGAGCCAGCA
CAGGCGATTGAGTGAATTCCTGACCTGACTGGATATCAACACAAACCGGGCCACCCAGCACCTGAAGCCCACCGACCAATGGTAAGAACTCGATCCAAAC
CGTTGTAGCTGTCTTGGCTTCCAGTATACCAATATTCTGTTGCATACATACAAAGTCACAGCACACTCACACCCTAGAAAACCGGACCCACACTTACCTG
GTACGATGCAGAAGAACACACAATGCCATGTGCAACTTCCTTGCGGAATTGCAGTTGTAGCGCCAGGCTTCGAGCTGATTTGTTGGTCACAGATACAGCA
GCCAAGAAGGGTTGTCCAACAGCCACTTCCTTTGGAAGTTCCTCAACGGTTACGGTGACATCGTTGTTCTGTCCGGCGTGGCCAGAGCTGCCAGGAACCT
TCCGCACCACTGGTTGGCTCAGCACTGATCCAGCTTCACCCATTGATGTTTTCCAGCCGACATGAAGCCGACCGAGGTTCTGCGAACCCTGAATGAAATA
TTTAGTCTTGAGCATGAAATAATACGAAAATGCAGCATTACCTGTGTCGTCAACAACGCTGGGTCCGATGCAGGGTGATACGAAACTCTGAACACTCGTT
GAAGCTCTTCCTGCGGGTACACAAGTGTCTGTGATCCATTGTTAAGCGACAGCAAATCTTGCATCGAAGCTTGTTCTCCTTCCTTCTTACCAACACCATT
CACAACCATTTCTTCCGACGTGAACGGTGCCAGTGGCAAAAACTTAATACTGTCCACAAAAAGCGGAAGTTTAGACGCATTGCGGATTTGGGCCTCTACA
ATTGCTTCGCCCTGTTGCTGTTGCGTTGGTGTTGAATTCTGCTTGAACGTAATGACCAATGGGTTTTGCACTGCAAATCGATAGAATTTCCGCAGCGACT
TGCTCTCACCCGTAATAGGGTCCACGTAGGCCACACCCACACGTAGTACGTGATTTCCCACCTGATTTAGAGGGTAATCCACAACCATATCCAGACTGGA
GCCCGCAGGCAGCACTGCGATAGGATTTGGAGGCGGCATCTTCCCCGTTCTGGCGTAGCGATTATCATGGAGCTCCACTCGGTCATTGGCACATTGAATA
TTGGCTGAAAGTCCCACATCTCGCAGTTCACACGAGTATGGATTGATAACACTGATGTAGCTGCTGAAAGTGTTGCCCAGGAATATCTCTCTGTGGTAGA
ATAATACACAAACATTACAATTAACAACATCTTGGTACAAGATTCTAGGGAACAGTGACGCACCCGAAGCTGTCGGGTAGGATGAGCATACTGGACAGCG
CAAACTCGTGTTGTGTGGAAGTAGCTTCAGACATGGATGTGGGCAACATGGAGCCTCCGCTAGCTCCTTGGACGTAGAGCTTGGGCTTGTACAGCCGCAT
CACTAGAAAATATCAAAACAAATTCAGAGGAAAATGCCGAATATTACATAATCGAGAGAAACACACAAGGAAGACAGAAGCTGCGGACCTTTAAGTGTAG
GTTGCACGGACGGGGGAGGCGGAGAGGGCGCGGGAGGAGCGCCGCCACCCGAAGAAGGCGGGCCGCTAGTCCCATGCGAGCTCATCTGATGAATGTGGAA
ATAATGATCAAATCTGCAAAGTTGTGTGGAAACACAAATTATGTAACACACATAATACGCTTCAATCATTTTGGCCGCTCATTCGCCAACAGGAGAGCAA
GATGTTGGCCCGCTCGCTGCTCCGTGCCGCCTCGAGCGCGCACAAGGCGCCGTCACTGGCTGCTTCTGCTACTAACTTCGGTGCTATGCAAGCTGCTCCT
TTCTCCGATGCCCCCACGGTACACTTTGCGTCGAAATTCGCTAAAAATCTGCGCTAAACGCACTCATTTTCATGTTGATTGGCAATAGATGCACGGCACG
ACGATCCTATGCGTCCGCAAGAAGGGCAAAGTGGTGTGTTATATAGAACTGCTGTTGCTGAAGATGGGTACTAATTTATGTTGTGTTCTGCCCTAACTTG
GAGCAGTGCCTGATTGGAGACGGCCAGGTGTCGCTGGGCCACACTGTGGTCAAGCCCAACGCCAAGAAAGTGCGTCGCATCGGCGAGCACATCGTGGCGG
GCTTTGCTGGCTCCACTGCCGATGCATTCACACTCATGGAGCGTCTGGAGGCCAAGCTGGACGAGTACCCTGGCCAACTTACTCGCTCATGTGTAGAGCT
GGCTAAGGACTGGCGGACGGATAAGTATCTGCGCCGTCTAGAGGCTATTCTGATTGTCTCTGACATCAAGCAATCGTACACGTTGACGGGCAATGGCGAC
GTTCTGGAGCCTCATGATGGCATCATTGGCATTGGCTCGGGAGGCACCTACGCTCTCGGTATGTTTGAGTTTAGCCGTGTGATTTAGTAGCTATGTTGAT
TAACGTGACGATGTGTTGGATAATGTAGCTGCTGCTCGCGCTCTTATCGACCAGGATCTAGATGCGGAGACGATTGCGCGCAAGTCAATGAAGATTGCTG
CCGACATTTGCGTCTACACCAACGAAAATTTTGTTGTGGAAATGCTTGAGGAAGGCAAGAACGATGGTGAGAAGAGCAACAACAACGAGTAAGCGAAGTA
CTAGCAGCATTTGCATTCAGTATTGTAGAGCTATCGAAATTCTGCAGCAATGCTGAAATCAATAAAGGTGCAGTAGCTATTTGCTGCTCAAGCGACTTGA
GCTGTGAACGCATGATGCAGGAAGGAAACACAACACCTTCTCACGGAGTAGGAGAAAGATGTGAAGATAATAGGCAGAGGAAGATGAAGAACACTAACAG
TTGTCACAGAGATGCCTGTTTCAACGCCACCAAATCAGATGCCTGCCTGACTTGCTTTGCTTGTCAATAGTAACTCCTTTATCGCATGGTACGATTGGTG
ACGTTGTAGCCTACTGCTACCTGATCCTTTCGTTCCTTGCTTCTCGAAAATCGTGATGATGATTGGAAGGCGTGTATAAATGTATTGGTGCGCTTGTGCG
CTTTCCTGTGTTCCTGTTGCTGCTTAAATGTTGTTGGCAATGATCGAGTTGTACTTGTTGATGTTGCGCTTCAGGATGTCTTCTAGCGGGCCCATAACCC
GCTTGAAAGTTTTACGGTCCAACGTGAGGCACTTGACCTTGCCCTTGGCTGTCACTGTAGCTTGGCGCGGTCGAGTTGTGAGTAGTGCGATTTCACCAAA
GTATGCACCTGATATGAGTTGTCCCATTTCCACCGGTGGGTCCGCGGGCGAGAGCTGCTTTGTACACACTGCCGTGCCTTCCTCAATAATGTAAAACAGG
TTACCATCGTCACCCTGAGTGATAATCACTTCACCATCACTAAACGTCTCTGTCTTGAGTGCATCTGCAACTGTGAGACGCTCGTACTCGCTCAGCGACT
CCAGCAGCGGGACACGCTCAATGAAACCCTTGTGTGCTTCGCGTTTCTTTAATGTCGTCTCCATGATGATGAACTTAAACGTCTGTCGATCTAATGCCCA
TGCCTTCGAGTGTTGCACTGCTTTCACAGTTGCAGCACGGGGTGCGTTGTACATGAGTGCCAACTCACCGAACGACATAGCCTCCGTGCACTGCATCAAT
CGAAGAACAACAACACAGACGTGTTAGCAACACAAAAATTAAGATCGTCGCAAGTGTCAACACGCACCGTTTGTACGAGATCGCCATCCTTGTAGACTTC
GCAGACGCCACTCTCGAGTATGTAGAAATTGTCTCCGTCGTCTCCCTGTTTGATGATAATGTCACCTGGCTCAAACTCCTTGGGGAACATGGCATCCAGT
ACAATGTCGTGCTGCTTCTCATCCAGCGACTTGAACAAGATGTTCTCTGCTACCATCCGGCTAATCCCCTCACTCTCCTCTGCAGACTTGGGATGCACTA
CGCGTTCAAATTGCCGAGCACTGCCACGTCACATCCACAACAAGTCAAGCTTAACATCAGAAAGGACAAAAATCCATTTCCACATATAGCAACGAACCTC
AGCGGGTCGATGGTTTCAGCGGACACCGACGTGCGTCGTCCCTTGGCCATGATCTTGGGCGGCGGTACGGGCGCGGCAATCTCGCCCACGGCGTCTCCGC
CCTCGTCTTCGTCCTCGCTTTCACTTTCGTCCGAGTGATCTACCAACGACAAGAACAGCGTTAGATCTCTCTCCCTCTGCCATGAATTGTGAACCGTCGC
GTACAGTGCAAATGGGGTGACGCAGCGGGGTTGTCATCCTTGGTGGCCCCAAGTTTGTGGCGCGGCGTGGCCTCCTCCGGGTAGTTGGTCTGCAGGTACT
GGATGATGTGCAGAATGGGGTTCTCGGGCTTGGCCAGCAGCAGCGACTCGACGAGGTTGATGAACAGCGTGTTGATGCCCTTCTTGTGCAGGTAGTCCTG
CAGCTCCTGTTGCACGCCCTCTGCGTCCGTCATTATTATCCTGCTGGTCTCTGTTCGGCTGCGCGAGTGCTGTCTTGGTAGTGAGCGCGGATCGCTCGCT
TGGAACTGAGCCTGCGTCACGTCCAAAATGGAAGAAACTGCTGCTAGCGTAGGCTAAAACAGCTCCGGTCGCTGAACACACAAAGATCGC