Description :
From Genome Similarity Track
Location :
Scaffold_593:3753- 6755
Transcript NameFunction/comments
Pytve_DAOMBR484fgenesh_masked-pve_contig_593-abinit-gene-0.243'5'-cyclic nucleotide phosphodiesterase
Pytve_DAOMBR484maker-pve_contig_593-fgenesh-gene-0.3Cytochrome c peroxidase, mitochondrial

Sequence
3002 bases(100 bases per row)
CGGGTTCACCAGTTGTGGCTACAAGTCCCGACAGACCGCGGTTCATCGGCGACCGGATGCTCTCGCCGCCGATCTGCGGTGTGATCCACAGTTCCTTCTT
GAAGTGGTCGATGAGCAACAGTCCGAAGCGGTCACACTGCATGATGTCTTTGCCGAGCTGCATGACCAACTCGGCGAACTCGGCAATGTCGGTGCTCTCG
GCGATGAAGGTCGTGAGCTGAAGTCGCGCTTCGATCAGCTTCTGCGCCGTCTTGACCTCGTGCAGCAGACTCGCCTTGTACAGCGACGTGCCGACCGTGT
CTGCGGCGTAGTTGAGGAAGATGGCGTCCTCGTGGGAGAAGTCTGTGCCGTCGACCTTGTTGACGGCCGAGAGCACGGCGAGGATGGTGCCATCCGGTGC
CTTGACTGGCAGACACAGAATCCGCTTAGTGACAAAGCCAGTTTTGAGATCGAGCGTCGGGTCGAACATGGGGTGAGAATACGCGTCGTTGGTGATGATG
GTCTCGCCCGTGCGCGCCACGAAGCCGACAATACCTTTGGCGATCGGCACATACTCGCCACGCACGATGTCGGCGGCGCTGGCGATGTACAGCTCGTTCT
CTCCTTCCATCTTCATGAAGAGTCCGATGCGCTCGGTGCCGAGCAGCTCGTGGCAGACGGAGAGCACCTGATCCAGCACGGCAGACGACACGGCCTCCAT
CGAGAGATTGCGGTGCAGCTTGAGAAGTCCCTCAATGCGGTTCTGCGCCGTCTGACGCTCGCGCGACAAGATCAAGTTCCAGATGGCAGCGCCGGCGACG
ACGGCGAGGAACTCGAGCATCTGCTTGTCGGTGTCCTGGAAGCGCGTCGGCGTGTAGTCGGCCAGCGGCAGCCGCTTGGTTCCTGACTTGCTGACCACTG
CTGGAGATATTGTCCGCGCAGTCGAGACAACTTGGAGAACACCGACGACTGAGCGGTTGGCGTTGCGGATCGGAAGACACAAGAGAGCGTGCGGTGTGAT
GCCTGTCATCTCCATCTGACGCTCGTAGTTCTCGTGCGCGAAGAAGTCTTCGATGCTGAGCGGCTTCCCTGTCATGAGAACGCGGCCGAATGTCGTGGGC
GAGTCCGCGGCGATGAAACCCTCGTTCACTGGGGAGGTTGCGTCGCTGGCACCTGCGAGCTGCTCCGGCTCAGTCGAGAAGATCTCCACGACATTGCGGC
GCTCGTTCAGGATTCCCAGCGTGTACTTGTCGGCGCGCACGAGCTTCTCGGCGGCGTGCAGGATCTTCACGATGACGGTGTCGAAGTTGCCCTGGGACGA
TATGTCTCTCACGGACGCCACGACTTCTTCCAGCTGCGCCACACGCTCCGTCGCCACCGACAGCGGCGGAGTCAGCCCCAGTCCCTGACCGCTGGCCACG
GCTGCCATTCGCTTCGGGGGAGAACGTGAAACATGTGGACTGCCGAACGACAGATCGCTCTGGCGATGGCTGGTCCGGTACTGAGCGAGCTGCTGCTCAA
CCTCCGCGGTCTTGGCGCTCAGCACGCGCACACGACGCACGGCCTCGTCCACCTGCGCCTGCAGCTCGCGCTTCTCGTTTTCATGGGCCCGCGCGTTCTG
CAGCACAATGCGGAGCGCGTCCGCCGGAACCAGCAGCGTCTTGGTATTGGCGTCGTTCATTGGTGGTTGCTTCCCTCGCCGCTTCGGAGTCAACTTGAAG
TTGGCGGTATTGAACCGGTATTGAACCGGTTTGTGAAGGAGCGAACTTCAACATCAAGTCAACGAAACCGTCGGAATCGAGCAGTACCGTACTGCATACT
GTACAGTTCGCACACCCTGTGCGACGATGTCCGCCCCCAATGATGATGCTGTAGAAGCCAGTGGGCCGGCAAAATGCCTTGGAGCGACTCGGCCGCCATG
GTGGCGACTGAAGCCAATCGACCAGTGAACCGAGTCCATCTAGCGAATGCGGATGCGCTGCGCTCATCTGCAGTGTTCGTCTTCAGCGCGCGACTGACGT
CAGCCTCAAGACTGAAGCCGCATCTTCAGGATCGGCCGGCAACGAATATGCATGGTGGCAATATGTTGGGACGATGAAGAGAGCTCGCTCATAGCAATGA
ACACACGGTATTGGACTCGCAACACGAGGGTTTTGATTGATTAACTTTGTGTTTGTTACTGTGACACCCAACGCGATCCTCCAACATGGCGGCGGCAGGT
TTCCCTCGCCTGACCGCGCAAGCGCGTGATGACGCTATTGGTCTCAATCTAGTCCTCGCGCGCGCCGAAGAAGATGTACTTGCGGCGGCCCGTCTTCTCC
GGGAACTTGACGCCGTTCTCCGTGAGCTTGACGAACGCCTTGCTAAAGTCCTGGAAGAACTGCTCCTCGTCCTTGGCGTACAGTTCCACGTACTTCTTGA
ACGCCGGGTCCGTCACCAGCACCATGTCAGCGGGCAACATCATCAGCTGGCCCGACGCGTCCTCGAACTGCTGCGGGCCGTTCCACTTCTTGTAGTGCCA
CTTGTTCTCCAGCAGCTCGACGAAGAACTGGTTCGAGAACGTCCACTCGGCATTCGTCCACGGGCCGCTGAACCCGCTGCGCGTCGGGTAGCAGCGGCCG
AGCGCGTGGCAGCCGATGAGCGCGACGATCTCGCGGTCGTTGAAGCCCATGCGGTAGAACACGTCGCGCACGTGCTGCGTCGTCTTTTCCTTGGAGCCCA
TGTCGGCGTTCGGCAGGCGGTCGTCCGGCGTCTGCTCCTTGGTCGTGCCGCTCGTGGCGTCCGGACGGCCGAGGCGGAACGGGATCGTGGGGCCGCCCAT
CTCCTCAATCATGGTCACGCCCGCGAGCACGTACAGGTCGGCGTACGTGATCTCCGGGTGGTTCTTCTTCACCTTCTCGAGCGCCTTGACTGCGAGGTGG
AGGCCGGCGTTGCCGCCGTGGTTGATCTCCGGCTCGAAGCGGATCGTGCCGCCCGTGCTGCCGCCCGATCCGTCCTTCTTGCTGTACGTGCCGGACGAGT
GC