Description :
From Genome Similarity Track
Location :
Scaffold_2:37529- 38793
Sequence
1264 bases(100 bases per row)
GCTTCCTCATCACTACGTGTAAGCAAGTAACGGACAGCACAGGCCCGTTACACCTGGTAGGACTTTGTAGTCCTTCCCATGACCAAGTTCACGAAGAGCC
AAGGTATGACGTTTGAAACTCCAGGGCCGACCCTGGAACATGCTGTTTTCCCTCATCTCACTCGTGTCGAGTGGTAAGCCCTTTACCGCCTCGCGGCGGT
GTCTGGTGAGGCTGTAATCGCGTCGCTCCTGAGCCCAGCGACGTCCGACCAACAGCACCAAGCAGCCCAAGAGTTCATGGAACGCGAGCTAGCCGATGCG
AATCGGCGAGCAACAACTCCCGCGCGTTCCTCGAAAAATGATGTCGTGAAGCTAGAGACGTCTACCTACTCCGGTGAAGGAGCGAATTACTTCCCGCTGA
ACCGGTGGTTGCGCGAGATCGACATCGCGATTGCTTCGAGAATGATCGAAGCGCAAGAGACAATGGTCAATTTTTTATTGTCCCGGTTGTCCGGGAAGGC
CCAGAAATGGGCCCTCGGTAAACTTGTCGTTGATTACGACGCATTCCCCACTCTGGAGTCTCTCCAGCAAGATCTCAGGCTCGCGTTCGAGCCGCCTCAA
GACGAGTCCCGCGTGCGTGCCAAGTTCTTCTGTCTTCGTCAAGGTAAAATGACTATGCGCAACTACGTTCAAAAGACTCGCCACCTCGCGTCATGCATCG
CGACAAAACCGATTGACACAGCATCGCAGGTCCATGTATTCGTATTCGGCATGTGTGAAGGCATGACACGGTACTGCCTGACCCGAGCGGAACCTTCCTC
TCTCGAGGAAGCATTCGCCCTCGCATTACGCGAAGACTATGTTGTGGCGGCGTCTTACGCGCGCGCGATGTCTACGGCAGCTCGTGAGTCAGCCCCCGAG
CCCATGGAGATCGACGCGATTGACGCGTCGAATAATCATCGTCAGTCGACTTCTCGTGGGCAAACGGCCGTCCCAATCGCCCGCTCACTTGCTTCCGCTG
CCGGAAGATCGGTCATCGCGCGGCGGAATGCCGCGCGCCAGCGCCGGTACTCGCGCACACCGCCGATGTCTCACCTGCCGTTCAGTCAAAAAACGATCAG
GGTCAGTAGGTGTGGGGCGCCCTACTGGCTGGAATGGAGGTCCGGGCCCCCCGTGCTACCCAACCTTCTAGCCCTCCTGTGCTCTACGCACACTTTAATG
CCACCACCACGTCGGGCGACTCGAGGCTGATCATCGTCAGTCTTCATGTCGCCGGCGCCCGGCG