Description :
From Genome Similarity Track
Location :
Scaffold_1:375286- 405261
Transcript NameFunction/comments
g121.t1XP_009515522.1 hypothetical protein PHYSODRAFT_309156 [Phytophthora sojae
g122.t1hypothetical protein
g123.t1hypothetical protein
g124.t1XP_009515525.1 hypothetical protein PHYSODRAFT_309148 [Phytophthora sojae
g125.t1hypothetical protein
g126.t1hypothetical protein
g127.t1XP_009515530.1 hypothetical protein PHYSODRAFT_343769 [Phytophthora sojae
g128.t1RAW31872.1 Lysosomal beta glucosidase [Phytophthora cactorum
g129.t1XP_009515536.1 hypothetical protein PHYSODRAFT_353499 [Phytophthora sojae
g130.t1hypothetical protein
g131.t1POM64265.1 Hypothetical protein PHPALM_20226 [Phytophthora palmivora var. palmivora
g132.t1ETM40573.1 hypothetical protein L914_13536 [Phytophthora parasitica
g133.t1GAX99613.1 cysteine protease family C01A, putative, partial [Pythium insidiosum

Sequence
29975 bases(100 bases per row)
GCAAGCGCTCAAAATTCTGCTGGCTTCGCCGGGTCTGATATCGGCAATCAGGTTTTGACTTTGACTCGCCGCGGATGGGCCCGAAAGGATCCGCAATTAT
AATAGAAAATCTTATCCGCGTTCTACGGTTTGGCTGGAATTTCGATGTTGAACTCGCCGATCGTAGAACCCAATCGAGCATCTCGCCGTGATGAACATTG
TACATTGCCGTCGCAGTAATACTCCTTGGGTTTAGGCGCGGTGATCCCCACTTCAGCCCTGCAGCACTGTGCCGAGCCAACGCCGTCGAGCTGGGAGAGA
CAATCAGCCTCTGCCATTTGGTAGGGCTTGGATTTGCACGGCGCCGTTAAACTTAACAGCGCCTTTGGGGCTCGTTGGTAGCTAATGCATTCAGCCCAGT
TGTGGGTTTGGTATGTTACGTCGGAAGCCATCTGCCAGGTGAAAGGGGCAACTCGGTCTCGATCGAACTTTAGTGGTCGAGCTGTAGCCTCTGAATCGCT
CCTCTGCCTTCGGGTGCAGGCCATTCTCCAACTTGCTCTCGACCGACTCGGAATCGCCACTGCACGGCATTTCGTTTCACTTGTGCAAACGCGAAGAAGT
TTCATCGTTTCCCGCAATTCCGCGCAGTGGATTCCCACCCGCTGTCGCGCGAAGGAGTCGACGAAACTGAGCCTCGTCGCCACCAACTGCAAGCAGCAAG
CAAGCGCCAATTCGCTCCGACTCTCACCGGCGAGGACTTGCAAAGTCTCTTCGCTGGTACAGTCCCAACTCCACCGCCCCAAGATAAACCGTGCCACTCG
CCAATTGGCCTGCCAAGCGCCACACCGCCAAGAGGCACACAAAAGTGCGATCCGCCACGCTAACATTGCCACACGGTGGCAACCACCGGCAACAGCCACC
AGCAACAGTATTTTAGCGCAAAATCAACCCCAGAACACCAGCGATGCCACTTTCCATCTCCTTTTACCACAGCAAACGCGGCGTAAACGTGGCCAGCTCG
TACCAGAGCGTGGCGTTGCACGACCGAGCGAAGGTGAAGCACAAAATGGCGCTGCCCTGCGAGTTTTACCGCAACATTTGGGGCACCTCGGAGGACGAGG
ACGTGGCGCTGCGGCGTCGAGCGCGCTCCACCAAGTTCAGCAGCTCCCCAGCATCCGCAACGTCGCGCAGATTCAAGAAGCGCGTGGCCACGGGCCCCCT
CGTTGACATTGCACAGGTGGCGCACGTGGTCACGACCATGTCGGACTTCCGAGCCGACTACGGTGAAGAGTCCAAGAAGGTGAGACTGGTCAACATTTGG
GATGATCGCAGTCTCGCACTAGGCTTAGAACCGGAGTCGGGCTCCGAGGCGTCTTCACTCAGCAGCGAACAGGGCCCATCCACTGCAGACACCGAGCCGG
AGGACATCATGTCCCCCATTTGCAGTCGAGCGGACAGGATCACGGAACTCAGTTGCGAGGACAGCGACGACGACCTCAGCAGTTTAGATTCCCTGGTGGT
TAACAACCTCCGACCAGGACAGCTCAAACGAGCCAATACACCGGAGATCGTGCTCCCCAGTATGAAGAAGAAATCCGGAGGCTCGGACAGGAAGGAGCTG
AATTTGTGCAACTTGCCGGTCCCACCTCCGTCCTCGCACAACGGCAGCATCATTTTTAGCGCCGTGTTTTCGGAGCAGCGGGATTGGAGTTGGAGTGCCA
GGTTCCTGTTGGGGATCCATGAGCCTATTCGCCACGCACTATTTGTAATGGATCGGTTCTTGGAGCAGTCTCAAAGCCAGTCCAAGCCCGAAGCTTCGCA
CACTTTAGCGCTGGAAACGCACGTGGCGGAGTTCTTCCTTTGGTTCAAGACATACTTCGTCGAGTATTTGCAGTGCCAACATGACGTCAAGTCGTCGGTG
TTGTTGCCGCTGCTAAACTTGCCCGTGTCGACCAAGCAGCAGATTCTGAATGTGTACCAGGACATTTCACAAATGCTGACGCAGATCCAGCAGCTGGAGC
GCGCGCTGTGTGTTAGTGGAGCCTGCAGTGCATCGTCCTGGTTGCTGCGGCTTCAGGTGTTGCAGACAGAAATCCGACAGCTAAACCGGTCGCTTCACTC
GGCACTCAACGTGGAAGAAGCGACTCTGCATCCAGCTATGAGCGCTGCCTTCACCGAGCGTGCATTCCAGAGCCACATAATGCCGCGCGTGTTTCGCGCC
ATTCGAGCTAAACGCGTCGTGGTGCCGTGGATCGTTGAACGGAGCAAGATCTGGGGAGGAGAAACTGAGCAGCGCAGTATCCAGGGCATGCTGCCCTTCT
CAGCCAAATTCATGTACCGGAAGATTTGGCGACCTTACTTCATGAGCAACGTAGCGGTGGCGATGAAGAATCTGAACGAGTTCGTTAGTTCTTCGGACTC
CAACAGCACCTCAAGCAGTGCGTCAATCTACAGCGAGCGCAATGGAGAGATGTGCTCCATCATGTGATGTGACAACGAGGTGGTCACTTTTGTTGGAAGC
GCTACAGCTATTTATTACGGCCCAACAGCAACTTTCATGAGCGTGTGTCGTGGCGTGACCTGAGCTAGCAGAGCGGAAGCCGAAGCAGCGAGTACAAGCG
GTTTATCATAAATGAAAATGCTTTCTATCTAAAATGGTGTTGCTCATGTTCATCTTTGATGGCGGTTTTGGCCATGGCATCGCACAAATTTTCTCGTGCA
AGACAATCTAATCTATCGACCGGCGTTAAAATCCAAGCCCAGCAACCGTTATCGTTTGGTTGGTTTCATGGTCCCGATCGCACTTTCAGTCCCATTCCCC
ACCACGAATGAGTGATCGTACTCATTAGCCAACTGCAGAATCAACATGACGGCCCACGAAAGAGTTCAGGGGAAGGACGAACCTCGCTTCAAGCTCGAGA
AAAAGGAGCCGATTGATGAGACAGAAGACGACAATTTATCGTCGGACTCGGCTGATGACGCCTCGCAACCACCTTTGCTGTACTCGGAAGTGCCCCGAAT
CGCTTGGGACTGGATCTGTTGGTCAGGTGCCAAGACGTTCGACGGTATGGACTTTGCTGGTGAGGTGCTCGCAAACTTTCTCGGGCTTACTCAGTCCAAA
TACCAGTGGATTCTTGACGCTCACGAGCGTGAAGAGGAGGAAGAGCTACAGCGTCGACTTGAAAAGCAACAACGACGTCAACTGCGTCTCGAGCAACTAC
TGGAGGAAGAGCAGCAAAAGCTTCAGGAACTAGAGACTGGTGCCCTTGAGGAAGATTCAGAGTCAGTCAAGATTCCGACTTCTACCACGGTGTAGCCTGA
CAAGTACGTGTGTATTATCAGTACAAATGCCTAACATGCCAACACGAATAAGTTGGTCGGAACATCCACTACTTCAATCATTCGTAAATGGACTTCGCAT
CCAATCGTGAATACTTGCGGCTTCAGTGTTTCTTGTCGACATCGATGCTATCCCAAAGTGGATGTACTGGTGGCTTCACTCCGGAGTGCAGCAGCATTCG
TACAGCTGCCTTCTCGATGCGTTGCAACTGTCGATTCACAACACTCTCGCTTTGGGGGGTAAATTGCTCTGTTCGGATCGTGAGGAGTCCTACACAACGT
CAAGACATGTATGTCAAAGCAAGCAACACACAGCAATTCAAAACCGTACCATTGAGATTGCCGAAAAGGACATCTGTCGAGTATCGGTCTCCAATCACGA
CAAGTGTCTCTGGATCCACTCCTCCAAAGTGCTTTTTCACAAATGCAATGCCCCCCGGTTTCTTTAAGTCCACAACATCAAGCTCAGTCACACAATCCAT
CCCTTTGAAAATCCCTTCCAGCAGTACCTTTTGGTTGTGACGTAGCACATCCACATGCAGTCCTTCCTCGATCTTCTTGGCCTGCACTCCGTCCTTGTCA
TCGATAGAACCAGCCGAATTGGAGAAGATCACGACACCTGAGTCTCCAAAAACTCGACGACATTCGGCCAGAGACGCCTCTAAATGCGGCGCAATCTTCA
GTTTATGAGGCTCCGTCAATGTGTTGTCCTTGTCAAAGATAACGCCACGGAATCCGCGATCTCGGAGCGTCTGGAACGGCACTTCCGTCACATCTGAAGC
GGCACAAAAGTGCAATTAGTAGGGAATTAAACATTAGAATTGTGCAAAACACAGTCATTTCATTTCTAAAAGAGATGCATGCCTCGAAACAGAGCTCACC
TTTCACCGAGAGCTGGGGCAGCAGAAGCTGCGGCTGGCGCACCAGCACGCGGCAGAACTCCGCCACGCCGCCCAGGTTGAGGCCTTTCATGGCCCAAGCG
CAAATTATTCGCATCACATTTCCAACCAATGCTGTCTCTCCAAGTCGAAAATTCATCATTCGTCAATAAAGGTTACGTCTTTTCTACCAATCCCATGACG
AAGCCGTTTCGACAGCCAGTGACGAGCTCAGAAATACTCGCTCTCAAGACGTCGGAGTCGGTATTAATCTCGCCGCTGCGTTGTCGCTTCAGTGCCTTCC
GTCGCTGCACCGACACCCCAACATCGTTGCTACGCGTCTTAGGTCCCCGTGTTCGCCTCTCCCAGCGTTTAACTCCGCATAATGGCCGATAACCCGCAGG
AAACGCACGTCCAGGACGAGGAGGAAGACAAAAACTCGAGCTCGGACGACGATTCGTCGTCCTCCAGCTCGGGATCAGGCTCCTCCTCCTCCTCTTCATC
GTCTGATTCTGAGTCGGAAGACGAGGCGGAGGGCGCCAACGCCACCAGCTCCGAGACTAAACACGCCGCTGCCCATGGAGGTGCCAGCCGCACAGGCCAC
GCGTTCCCCAATAACAACGCGGGTCCGGCCCTGTCTGCGCCTCGTCCACATGGGATGGCAGCGAACACGGAAACGCTGAACGTCAATTCGACTCGTGCAG
CCGCGAGGTTTAAAGCTGCCGAGACGGAAGGGATGATGCCTCTGGGCACTCGCAAGCGAGACCGACGCACCATTGAAGAGATCCAGAGAGATTTGAGGGA
CAAGAGGAAGAAACCACTGGGGAACCCCGCGGCCAGATCCAGTCCACCCCCACCGAGAGGTTCGCCAGTGCGATCTCCGGAAGCCGAAGCAGTGGTGAAT
AGTGGCGCCCCCATGGCGGTGGGTGGCCCGCTGGGTCAGTTCAGCGCTGCAGGACGTCTGCCCATTAAGAGGAAGCCGGTGTCGGCACACGATAGACTGG
CTATGAAGCTCAATGGCCGCAAGACGACAAGTGCCAAGCCCAAGAAGACTGCCACGTCAAATACTGGAACCGCTGCTGTACCGCCTGTGGCAGTGATGAC
GAACAAGAGTGTCACCAAACCTATGACGGCGACGAGCTTGGTGACTACGGGAAACAGTAGCAGCAGTGACCACGGAGGTGATGCTGGAGGCGATGGGTAT
AGTAGCAGTGCTAGTAAGGCTTCGTCACCGGTGATGGATGGCAAGGTGGTGCGAGCACTACTTCGCGCTATGCTCCGTTATGGAGACCTTACCGATGTGG
ACCTTTTTCAGACAGCTGCAAATTTTGCGGACGAGTACAAGATGCCCAGCTTTATTGAGCGCTCCAATCTACCCGCGACTACCCGAATGGCGAATGACAG
TTTGCTTAATCTTGCGGCTGAAGTGGCACAGAAAGCTAAGCAGGCGGTCGAAGCACGACCTCCGCATGACAGTATTAAAATTGGCGAGGTTGAGGCCAGG
TCTTCGCAGATTATTGAGCGCCTTTACGAGAACCTGAAGCTTCGTGTTGCCGTTCAGCGGGCATTGCGCACGGCAGGTTGCTCGTCCGGTAATGCGCAAG
TCAACGCTCAAGGTGCATATGTACTGGTGGCGAAACAGAGCGATCTTGCTGTGCTGGGAGTCAATACGCGGGACCTGCCCAATTGGACTTGGGCTGAAAA
GGAACACGACTGGACACCACGCAAGGATGCAGCACTGCTGCTCGGCGTTTACGTGCACGGTTTCGGCGGCTGGGAAGATATTTTGAATGACGACTTACTT
CATTTTCAGGGACAACGAGCTCTTAAGGGCGAGCGCTTAAAAAAGCGAGCTGAGAACCTGCTGAAGCGGCTTCCCGCCCCTGATCTGGATGCTGGTGAGC
CTCGTATCGTGCAATTAGCCAGCTCTCTGAGCTCCGCCGGCGGAAACTCAAATCAATCGCTGGGTGCTCAGTTTAGTGCTATTATTCACAGTGGGGTCAT
TTCAGGCGTGACAGCGTCCATCCCTGCTGTTCCAGCTACAGGAAGTGGGCGAATGCAGCGCGCAGCAGAGCGGTTTGCAGTACGGCAACAGAATGGTGAA
GATCCAATGGGCCGCCGGCATGCTGGGCTTGGCAACGGCTCGTCGACTTTGAATGGGGATTCCGGGCGACAACACAAGACGCCAGTAACGAGATCACCGG
CGCAGGCAAATGTGGCTGATCACGAGCCTGAAGACGGAGAAGTTGGAGGTATATCACCTGCCCAATCGACATCGTCACGGCATAAAAGGCGTTCGTCTTC
AGTGGAGGATGAAGACCGAACATTATCCCGTAAGAAACACCGCAATAACAGCAGTGAAATCTCAACCAAGACGGAAAAGCGTAAGAAAGAGCATCGCCGG
AGCACGCGTGAGAAGAAAAACGATTCGGAGACACCGGCGATGGCGGCGAATACAGTTGCAGAGGTAGCAGCCCCACCACTCCTCTCAACCGACGAGTGCT
ACGAGAAGTGGCAACCAAACAAGGAATTGCGCGAGATCAGGCAAGTGCTCAAGAAGATGAAGATTATGGCCGATTGGTCCCGCAACCAAAAGGACGAGAC
CGTTGTTGAGAAGGTCTTCAAGTATGTGAGCACGATTGGGGAGGCGATCGACCGTATTGTTGCGCAACACGCTGACAAGGCTGAACACCACCGTTCAGAC
ACTCGTGAAGTTGATGAGCTTTGCACTTGTTTGTGGACTTATGCAGCTGGGTTCACGCCATTCACACCACAGGGCTTCGAACGTCTCTACGACGATGTTT
GTGCGGATGGCGACGCTCTCGTCGCGACTACCGGTAGGTCGTGATGATTCACAGATGAAATGTCAGCAGGGCACTCTAGCCCAGGTGCATGTACAGAAGG
AGCTTGGGAAAAAGATAAACCTATCAACAAGATCGCCTGTACCCAGCTTGTGGACGCCAAACCTGTACCAGCACTTGCCTCGCTCTGCCTGGACGAAACG
GTCGCAATCAAGCGAAGTGACCGTTTGCATTGAGGAGTTGCCAACGAGAGCCGAGCTCCTCGTGGCGTACTGACTGATGATGTCCATGTTGCTGCAGCCT
CCGCCCACGGCAGAGGAGCTGGCGCTGAAAGAGCAGGTAACGCAGGTGCTGACCAGTCAAGGCGTGCTAGCCAAGCTCAAGGCAGAATTGCGCGCTGCAG
TCTTTGAGGTGATGCACGAACGCGAGGGGTTCGTGAAAAGAATTGACCCGGCGGCCCCGAAACTGAGCGATTTCCCCATTGAGACTAGGACAACTGCATT
GGCACTGATTGTGGAGTGCCTGCAATTTTTCCACTGGAACCACGCACTGCGCGTGCTGCTTGCAGAAACGGATGCCGAAGACGAGCAGCATGATAGTGCA
CGGCTGGCTACGAAGCTCAGATTGGCAAGCTCCTCGGAAACGCCGACACTTTTCCAGCTCATCGAGTCTCGGGTGATTGGTGGCGACCAAACTGCTGATT
CTACTGGGTCCGTGCCGACTCCGAAACAATTTGATGTCGAAGACGATGAAGAAGAGACCCAAGCAGTGAATATACCAGCACCAAAGACTAAACCATGGGA
GCCTGAAGAAGCTGTCCACCCATTGCCATCAAAAGAATTTGAAACCACGGAGACAGAAGCTGCTGCTGATGAAGGTGAGAATGAGGTGAAGAATGGAACT
GATGATGACAAGGGTGAGAGCAGCGCAGAGATCGAAGAGAGCATGATGGAAGAGGTGCCGAGTGGGTCGGAACTAGAGGAATCAAACTTTACAAATTTCG
ATGATGACGAAGAGAGCCACGGTCGTAGTGGCACGGACACCAAACAACCCACTACTCGCTACCCGTCGCAGGAATCACACAGTGATGCAAAATATCAAGA
TGAGAGTGAATGCGTTGACGTAAAATTGGCACCACCACCACCAGCACCTGCAAAGCTGCCGGCCTTGCCACCGCTAGTTAGCACACCGATTAACACTCGC
GTTGAAGATGCAGAGGACAACTTCGATGCGGTAAGCGCTCGTGGTATGCGGGTGACCTTTCTGGTATCCTAATTTGTATTTCTTCTGGTGTAGGAGGAGG
AGGTGGAACGATTGAGGAATCTGGATGCTGCGTTGCAAGCCATGGAAGCGGATGATGACACGGGTACTCTTCAGCAATTGAAAGCATCTTTGCAAGTAGA
GCTGCAAGAACAAGACAGTTTTGGAAGTAGTGGCGGACGACTTGGCCGTCCAGACGATGAGGAGGATACTGAAGCCGAAATAAGCAAAGCCAGGGACACC
GAAGAGGAGGAGGGTGGATATGGTAGCAGCGACTTTGAGGAGGAAGAAGAAATTGCTAGGTATTGGACGTCGTGCACAGGTTCATCTCTTCACTGATGGT
ACTAACTTGTGAATGTGTTTTTTTTCCAGCGAGATTTCAGAGGAAATGGAGTCTATGTCGGAGCTGTCCGACAAAGAAAGCGACAGTGTAGATGGCGCAG
CTGTGTTAGCAGCCGAAGTGGAGCCACCCCGTGCTCTTCGAAATGACACGCGGGTTGACAGTGAAAATGCGTTGAACAGCTACGACTACATTGAAGATGT
TGAGAAGGGTAGGTGGTGAAACGCTCGTGGCAAAGTGTACATCGCCTTCAATGGCTACCAAACAAGTACTTCGAAGTAGATCACACAAAAGAGAGAGGCG
TGCATGCACCTCTTTGATTCTCAGTATTCTAGCTCTTATGCTTCTTATCAAACGGTTGGTCGAATCGGTGACGATGGCAATCGCAGTTCCTTACTTGCGG
TTTCCCGATCCAACAAGCTTGTTCAGCAAGTGTTGGTCTTCAAATGCCTCCGGGTGAATGAAGTAGTGGCGATCACGCGCTTGGAACGTCACCATGGGGT
GCATCCCCATGGTAGGGGGTGCCACCTCGGACAGTCGGAACGAGCTGTGCTGCAGCTGAGCGAAAAGTGTCACCGTCTCAACAGTCACCTCCGGGTCGTC
CTCCGAAGGGTTCACCATCCACATCCGCATCACGTACGGCTTGAACAGGTAGTGGAAGAGCGACGTCGTGCCCAAACCAAACAGCATGATGGTGCCGCAC
ATTGCCCACTATACGAAACCGAACCAAAGCAAGCCAACAACAAAAGCACAATCACATCAGCACCTTTAGCAACAACATTGAAATCCCTCTAAATCTGCAT
TGCACGCTGACCTTGCCGATCATGGACGCGTCCTGCTCACTCAACAAGCACAGAACTGGCATGCCCATGGACGTGAGGGTGCAGCTGGTGACGGACACGG
CCTTCATGAGCCGCACCGCACGCGACATGGGTGCCCGGTACACCTGGTTCTCATCTGAGACCGCGCCTTGCTGCTGCAGCTTCTCCACCTTATCAGCGTC
TTCACCGGCGCTCGAGCTGAAGTGGCGGCCAACAAACGATCCGTGGAATCCAATGACGTGGCGGCTGTTGAAATCGAACGAGAGACGTTGTAGCGCGGCT
GCATTACCAGAGCGACGGGCGACACGCGTCACTGCGCACAGCGACCGAATGGGGGACGGTAGCGTCTCGGCGAGACGCACTGCGCGGCGAGACGTACGCA
GGATCAACATGGTTTGCTTCTGTGGCCACGCACGACACCAGTCGTACCGGTATACCGGGGAAATCGGTAGCGTACTTAGGCGGATCTGGAGTGTATCGGC
GGGGGACTTGTTATTGTTTTGCATGTGTTTTGTTTGTTGTTTGCAAGTTGTGTGAAGGTTCGTCATTCTTGCGGCAGCAATAGGGCTGGCTGGGATGGAT
TGCTCACTCCAGACGTGGACGAAGCGCGGCTCGGCCGGAACCCCTCGCCCTGGTACGTCCTCTGCAGATAGCAGGCATCTTCCTGCGATGAATTTAAAGT
CGCTACTTGTGTATTCTGCGGCGTTGACTCAGATCGAACGGATTCCCGGCGATCAGTGGCTTACAGTACAGTGCATGCATTAATAGTGTGGCACGTCAAA
CAGTCAGAACAGTAGACACCAAGCGCCAACACCGATGCAACCGCGATTTGCGAGGGTAGCCACCTTGACAAATGCAAATGTAATCGAGTTGAAAGAGATT
TGCAAGTGTTGGCATTGCATAGGTCGACTCCCTGTCAGTTTCTGCATTGTCAAGGCGATCAGCAAACTTCGTCGTTGAAGTTTGCTGTAACTTGAACGGG
GTCTTGCCGTTGACGCATGACGCCGTTCTATGCACCTCATATGTGGCAGCAGCCATCTGCTGTTTGCTGAAGGTCATGGCGATCTTGCTCGATTGGCCAA
ATGCCCGCCTCGCTCGGTGCGCCATAACAAGCTGCAGTAGTCAAGCAAGGATAGCCACATCAAAGAGCAGTGAACTGTGTGTCTGATTCCTTGCATGCAG
AGCGCTCCAGTGGAACAGCCACGGGGATTAGCGCCACCGAATCCACTTCTTCCCGCCCGATCCTGCGCGCTTCGATATTTATTTCGCGGCAGGCCGTATC
GGCAATATGGGAAAAACGCAAAGTGTCCTCACTGCGGCTTGTCCCCCATGAACTGCTCGGCGATTCTTGCCCCGTAGAAATTGGCGTCCAGCCTCTAATC
GCTATGGATAGGGCCACCACGAGACGGTCGCAATTACATGTATAATAAGTTATTATTAACAACTGCTTGGTCGATATGTCCATCGGCTATGGTGCAGCTT
CTTTTTCGCCGCATTCTATGTTGAATCGCTTCCTCGCGTTTTTTGTCCAATTGTCGAAGACCGAGAAGGTCTCCACCCATACGAGCCGCTCGTTCCGCCT
GAAGCCCGCCTGCAGGCGAGCCCCATTCACAGTCTCTCGGGGCGGTGCTTGAGCCCTCCTCTTCGAAGATCTCTCTCCGTCTGCCCTCCTCTTTCCCTCC
ACCAGGTCTTTTTCGCCCATCATGCAGCCGCGCCGACAGGCAGGAAGCGCGGACTCGACGGGTGGTGGGGCGCCTCGACGCTCGTTGATGAATCCATTTG
TGCCCCAGGCGGGTCCCCACCAGGGGCCGCAGCCGCAGCCTCCGCCGATGAGTTTTCTGCAGTATCCGATACCAATGGAGACTTCTATTCGGAGCTACAA
CCCGCCTCCGCAGCAGCAGATGCCGGGCCGCTATTGGCAGACGCCAGCTTCGATGGAGCCACCGCCGACTTCAAGCTACGGGAAGCAGGGACGCCACCAT
GGCGGCAGCTTGGACTTGGGAGAGTTCAGTGACATTCTGGGCACCAACGCGTCCCGAGGTGGGGCTCCTGGAGGGACGTCATCAGAAGCGTCCGAGATGA
GCATGGCCAGCTTCGAAGTGGGCTCGTTTCATGACGGGATGGCGAGATCATCGATTGAAGATTCGGACGGATTCCACTCTGGAGTAGCTGCCGCAGCAGG
GGCTACCATGCAGGCCAGGCTTCCAGCTTCGGCGACGGAGTTGGTGCCTGCGAGACTCAGGAAATCGACAAAGACTGCTGCAGCTCCGAGTGACGAAGAC
ACCAAACATTTGGTGGATGCTGCGTACACGGTGAGCGAGTCGCAAGACGATCCGAAACTGAAGGTTAACACGCTCGCCAAGGACCAGAACGAGAGATGCC
AGTTCCATGGCTGCCCGAACCGAGCACGGGTAGCACAAGCGTACGGGAATTTTTGCAACAGGCACGTGATTGTTGCGCCCTGTGGGTTTCCTGGCTGCCG
GGATAAGGCCATGGAACGAGCTGCGATGTGCGTGAAGCATATGGAGCAGGGAAAGGAAGCGTTGCAAAAGATCTTGGATGCCCGCTCGCAAAGTGTGCCG
GTATGCCGGACGGCTGGGTGCTTTAAGAACGACCAAGGCCGTGGGTATTGCCGCGGTCATGAAAAGCTGTTGATGGCAACCGGACGTCTGCCCGCGCACG
TTAGCAAGCGCCGCCTTAACGGTGCGTACACTATGTGCAGCTATCCCGAGTGTACGAGGCATTCCCAGCGACACCATTTGTGTCGAACCCACGGGAATTT
AATCGTCAACCAAGCTAGAGAATTGGCAGACCGACCCGGAGCTACTGAAAGCTACGACGAGATCTTGGGCAGAATGCAAAAGGATATTCGGCGCTGTACA
CATGAAAATTGCACCAAAAACTCGCAGCGAGATCGATTGTGCACGATGCACTATTATGAAAAGCACAATCTGCAAAAAGATAGCTCTGCTCCCGTGGATG
CGGCTTCGGCTTCGAGTACAACACCACTGAATGAAAGTCTTGGATCAAGGCAACAAGGAATGGGAAATAGGGATGGAAGTGATGTACGAGGTGTTGAACG
GACTGGATGCGGGAAACCAGGGTGTGGAAATCTGTCGTACACTGCGGGTTTGTGCGTGCAGCATACAAAAGAAAATCAGGATTTAATCCATAGTCAAGGC
CGCTATTGTGAGCCGTTCTCATCCGGAGACAATGGTGGAATGCTGGCTGCTGACATCGAAAATGAGGAAAAACCGGGTTTGTTCACCATAAGCGGAAAGC
AACAAAGTATTGGTGTTTCCGGTTCATCTGCTATAGCAACGTCGATGAATAGTGTCACCACGACGTGCAGTAACCCCATGTGTGATCGAGAAAGCTACGG
GCGTGACTACTGCGAGATGTGCCAAAAGTTATTTTCTCCTCTTGTTGTGTCGATAGGTGAAATTCCGTCCGGTTCACACGGATATACTTTCAATTCAGCC
AATGCCCCGATTGTTCAACCTGAAGAAAACGTTTCACTGTGTCGAGTGGGAAATTGCGGGCAAGAATCGGTCACCGGTGGGTTATGCGCAACGCACTTTC
GGGCATTTGAGACGGGATCTCTATCGGTGGATCAAGTTAAGCTCAATTCGCATGCACAGCAACGTCAACAGGAGTTGGCGGAAGCGGCAGCAGCTGCTGC
AGCAGCGGTGGAAACGAAACAAGCAAGTCCCGCGGCGCCTGGAAAGGCGAGGAAATATTACTGCAGAGTTGAAGGGTGCGGCAAACAAGCTCAAAAGCGG
AATTTGTGCAAACGTCACTTTCGCCAACAAGACGCCTCAGCAGGAAAATCACAACCAGAGATTAGACCGAGTGGGCTGCCAAGCGACTACGTTCTCGGCG
TGCAACCAACCGAATTTTCTCATCCAACTTTAGCTTGCCGCTTTCCTGGATGCTCGCAATTCACAAGTAGCGGCGCTCTGTTATGCTTGACTCACTCCAA
GGCAACATTTTGCTGGCACCCAGGATGCGAAAATCTTGTGGGCCATCAACAGTTCTGCGAATTCCACGCCTTTCGGAAACAGTGCGCATACGAAGGTTGC
TTATACACCGCCCAGCTGAATAGGAGTGGCTGCGCTCACCACGCAATGTCACGGAGGTGCTGCCATGAATTCTGCGATAAATTCGCTGTGGGATCGGATA
GCGATTGGTGCCGGTTGCACCAGATAAGCTGCCAGGATTCTCCTTGTGTGCTGTGCCGGTTGCACGCGCCATCACTGGATGGTCTGACCGCGGGTGAAGA
CGAGAATAGCAGTCGTAGCCGATACAACGCAAACTTGAGTATTTTGGCGACGAGGGAGATTCCTGAAGGCGGCTTTAGCGGCGGCAGCCCGTTTAGCCGC
AATCCGCGCCTGATGTAGAGTGGCAGTGCAACGTGAGACAGAGGCGATGCATCGTAGGAAAGGAATTTTCAAGCCGGGTAGCAACACGGAGGGAGAGATC
GGCAGGCAAGATACGTCGGTCGTTGGCTTTTAGGTAACGAATTGGAGTAGTGTATGACGAGAAGGGGAATGCAAGTGAATTTACAGCAACCATGCTCACC
TCATAGTCGTCGTTACCATAAATTCTCCGCCAAGATTTGCATACAAAACCAGTTGCACTCAGCAAACCGGTACCCAACCGGTTAATCTTTAGTTCTTCAA
CCAAGCTCGCGGTCGCATAAGCAGCGCCAATGGAACGGATCTACTCGGCCTTCTTCACGTCGGAGCGGCGCCGCGAGCCGCCGGAGCTCACGGCCGCGGC
GTTGGCGCTGCACGATGAGACGCAGAAGTCGCAGAAGTCGTCGCCGCTGCTGCTTCCTGCCGACGAAGGCCGCCGCCGATCCGACGCCGATGGAGAGGAA
TCCACAGCCGCTGCCAGACGCCACGCGACCGCCAGACGGCAGGATCTGCAGAAGATGACGATGGACAGGGTCAGCGTTAAGAAAGACCTCAAGGCGGCGT
GTCAAGCGGCCGCGAGGGCTTTTCTCTTGGCTTACGGAGCTAAAGCGTTTACTGCAGTGCTGCTGGCGTCGAGAAAGTGGAGCAGCCTCGAGTATGGATA
CGCAGACGCTGCGAGGCTCCTGTTGAAAGGGGACACGCTCCGGTTCGGAGCCTTTTTGGGCAGTTTGGTGGGCGTGTTTCGAGTTACGGAACTGGCGGCG
CGAGCTGCTCGTGGGGGGCAACGAGACGCGGTCAACTTGGCTATTGCAGGGGCGATCTCCGGCTCAGCATTGCTGCTAGACTCGCCGTCACGACGCAATA
CCATTTCGCTGTACATTTTTGTTCGCATGCTGGACGTGGTGTGTCGCCATTTGACGTCCATTGGCGTGTTGCCGACGTGGAGGTACTCGTCGGAGATGCT
CTTTGCTCTTAGCAATGCTGCTATTATGTATTCGTTTGTCGTGGACCCGAGTCTGCTACCCAAGGTAATCATCGTTTCCTTGTATTTCAGCTGAAGGTGT
TGTCATGATAACTTCCTACGTGGTGCCAGGGTTACTACCAGTGGATTTGCCGAATTGGCGCTGTAAACCATCAGGGGCTTGAGTACACTGTGCGTCAGCG
CATGCACGGACAACTAGACGCGCGTGGGCAACCGATTCCATTTCGTTTGTGCCAGCCTCACTACCACATGTACGTTTGCCTGTCGAGATTTAACGAGCAC
CATAATGCTCAATGTTTTATCATGTGCCGACGCATCAGGGAGTCGTGTGTGACGCACGCTATTAAGGAGTGGGTTAACGGCTTAGGGAGATCGATGCAGA
TTTACCTCCCAGTCCACTTCCTTCCTGCAATGATCTTTCGCTTCCAGCAGCTTCAAGGAGCTCCAGTGTCAACGACTGCACGGATTTCCTACGCTGCTCT
ATGCTCGTCGGCGTTCCTCACATCGTACCAGGTGCGTGAACTTTTGAACTGATCGAATCAAAGTATCACTAGCGGGCGTTTAAACCTCATGTATCCTTTA
TTCAGACGGTCGTAAAGCTGGTCATTTGCACCGCTCGCAACGCTTTTCACCGAGACTTTGCTGCGTCGTCGCTAGTCGCTGGGGTACGTCAAAATGCTGA
TCATGATGTCATTGAAAGCTATGCGTTTTGCTAACGCGTGCGTGGTGGTTGCCAGGTCGCAACGGGTGGTGCCCTGTTCTTCGAGCATTCCAAACGGCGT
TTCGAGCTCATGCTATATTGCTTCCCACGTGCGCTCGACATTGTGTGGCAGCTTTTGAGACGCCGCGGCCTCGTGCGCTACGTGAAGCATAGCGAGGTAG
TGTTGTTTTGCCTCTCCATGTCGCTCATCATGTCTAGTCCGGCCCAACATTTCAAACCGACGTATCTGCGGATCCTGAGGTTCATTTTCGGCCGTGACAT
TATTTAGCTCACGCAGCTTGCTCTCCTTCACTGGTTCGAGTGCATAACATAATGAATGCCTCCTCAAATTGGTTCGAGCATGCATGTCGGCACGCGTTTG
TACTTCGACACGAGACGCTATAGCGCAGGCACTCGAAGCTGTAGTGTATTGTATTCACTCATCGATCGACTAAATTTTTGAACATGATTAACGCAGATCC
ACTACTTTAAGCCGTTAAGCACAAACAGATCCAGCATTTGCTTGGCCTCCTCAGGCTCCGTCATCGGCACGAGGTGCCCCGCTCCCTTTACAGTAACGTA
CGTGATCCCCTCGAACGTCTCCACAAAGCCGCCCGTTTGCTTGGAGTTTCCCTCCGCATAAGTCCAAGCTGAGCGAGGCGCCAGGCGGGGAAGACCCAGC
GACTCCACTGCCCACAGCCCACCCAAAGCATTGCAGACCAAGTCTGCATCGCCGTGGTATATCACACCTTTGACTCCGCTCTCGAGTAATTCACGCCATA
ACGGCGTCACCTCACTGTTTAGTGTAGGTGTGTATTTCAACATCTGCGGGTGCTGGAGCATGGAGTGGTCGGCACCGAGAATCGAGCTGAGAGTATCCAT
GGTCGCCGTAGTCAGAGCGTCGCCACTCCAGTGTGCCAGCGCTGGGTTTGCGTGCATGGCGTCGCGGACCTCGGCCATGTTAAAGTATGACTCAAGGTGC
CTCGTGTCCAGACACAAGTCCATTGTGTTTCCAATCGGGTGTGGCAGTTTACCAGGTGTGGACGGCGTCAAGATCTCCTTGACGAGGCGTTCGACGTCCT
CTTTCGGTGAACCAGCGCACGAGCCGTACACGTCATACATGTTGATGCGGTCGTAGACCAACGTCGTGTAGATGTCCATCGTGGCGGTCGTGCACTCTGG
ATTACCGGTAGCATCACTCAGACCCGGCGCCATCAGGGGACTTTTTTCAAACTCGTGCAGGACAGGACAGCTCGTTCGGAAGTTTTGGTATGCTTCCGTG
CTCAAAAGTCCATGGTAGTACGCGAACATGACAGTCGAGAGACCCATGTACTCGTTCACGCCATTGCCCACGACGAATTTCTTCAGGTTGATACGTTTGG
CTGGATCTGTAACTGCGGCGTTGCCTTTCAGGATCGCCAGCGCCGTGGTAGGTACGTAAATCCCTCCGTAGCTCTCACCGGAGACCACAAAGTCGTTTTT
TCGTAGCCATGGGAACTTTTCAAAGAATTTCTGCAGCGCGTCGTACAAATCTTGCGCCTGTGAGCGATCGTCCGATTCGTAGACTCCGCTGGAGTTGTAG
CTGAAACCGACGCCTACGGGGGACTCAATGCACAGCAGATTGGCGCGTTGGTTCCACGCAAACCTGTTGGCTCGCAGCGTCTTGCCATCCTTGTTCACGA
GGAGCGGGCCGTTCTCCGAGAAACAGCCCGAGAGGGAGCTGGACCCGGGGCCGCCATTGAGCCACAGCAGCACGGGGTCCGTCTGGGCCGTGGCACTCTG
TGACTCGGCCAGGAAGTAGAAGGCGTGGCCTCCATTATGGAGCGGCAAGTACCCCGAGAAGAGCCGCGCCGTGTAGTCGCTGGGCATGCCCGCGAGCGTC
AGGATCTCGTCGGCGGCATGACTGGGCACCTCGGGTGCTTCGGCGTCGGCCGAGTCTTCCATGACTGTGGGATCGGGCGTGCGCTCGCCCGTGCGGATGA
GGTTCTCGGTCTGCAGCGAGCGCTGGAGCGTCACCATGAGGTCCCCCACGGCCAGGAACAGGAGGCAGGCCACGCCGTAGCGCACGAAGCGGCGGCCAGT
GCTGGACAACAGGCGGCGCGAGCGGCCCGCAGCCGGAAGCGTCTGGCGCGACCGCAGCCCGCGCGTGAGCGGCAGCGTCTCGTTCAGCGGGTCCGAGCGC
TGATACATTGCGATCGTCGATTTCCTCCCCTTGACCTGATGTGAGGTCCAGCTCGAGGATACCAGAATGAGACGGAAAAAGCAACGCTTTCAGCGGAAGC
ATTTTGTGATTGGAGGAAGAACTCGAAGCAGAATGTAGGTATCTGTTTGGTGAACAATGTTTTGTTCCATGTGTTTGAATGACTTCACTTGCTGTACGGT
AGTCTCAGGTACTGTTCCAACGGGCCTAAAGAGAGCGGGGCTGGCAGCAATTGGCCACCGTGTATCGATAGTCAAGTGCAGACGACTATAGTAATGGAAT
CAGCAAACAAACGTAGCTTAGAAACGAAGGCGTCGAGAGCTTCCTCTCACAGCGATAGCCTGTGCCGCTGTTAGACCCGATCGCTGGGTCAGCATGCGCC
ACCGGAGCAGAACCATACAAACGACTTACCTGCTTGGTGGGCAGGCTGACCAACAGTACTTTCTGGTAGCAATCTGAGTTGATTTTGAGTAGTTGACTAC
CTAGACTTCTACCCAGAATGGGCAGCACGCTTGCTTCGCCGTTGGACGACACGGCCACTCGAGTGCGGGCGTCCGAACGCAACCTACCAAGTAAAAGAAA
GCGATCGCTAGGCCGACCGCACACGCTACCAATATCGCCTCGGTCGTTGGCTTATCCAGGAGGGAGGAGCGTGTTGTCAAACTCATCGTCGTCGGCCTCG
TCCAGGAGCGTGCGTGTGGCGCCCTCGAACGTCGAGAGGTCGCCCAAGTTGTCCGTGACGCTGGTGCTGCGCGCCATGGCAATGACGCCGCTGCGGTGGA
TCTCCGTGATGCCCAGGGGCTTGAGCAGGTCCAAGAAGGCCTCGATACGGCCAGGAGTGCCAGCCAGCTGCACCATGACCTGGTCCGGTCGCACATCAAT
CACCTTGGCGTCGAACAGGTTGGCGAGTTCGACCACCTCGGCGCGAGATCCAGCCTCTGCAAAGCACAAGCAAGTGTTCCCCGTGAGATCCATGCACAAG
GAGCATTCCGGTGGTAAGGGTTGTCAGTAATATGGGCTTGGACGTACCGGCCGTGGACACCTTGGCGAGCATCAGATCGCGCTCGACGTAGTTCTTCTGG
GCGTTCTTGCCACTGCTCAGGATGTTGACGACCGCGACGTACACGACGTCCTCCAGCTGCTTCTTCATCTGCACAGACACAAACGCATCCAACACTTGTC
AACTGCATTGCTACTTTTCCCACGGCTCAAATCTGCTGCACGTACGTTGACAACGCTCTGAGCAGTGCCGTTGACGACGACCGTCATGCGGGAGAGCTCC
TCGACCTCCGTGCGGCCCACCACGAGACTGTCAATGTTGTATCCTGCGATGCGCAGACGCACAACTCCATCAGAACCTTCAGTAGAGCAGTTGCAATGCT
GGAAATCCTATCTACCTCGGGCGGCGAAGAGGTTGGCGATCTCGGCCAGACAGCCAGGCTGGTTGACCACCAGCGCGGCGATCACGTGGCGCTGGCTCTG
ATCCGCCGCGCTGAAGGCGCGCGAAATGAGCTTAGGAGCGGCGCAGGACGGCGTGATGGTGGCCGTGGACCGCGGGAAGGCGCGGCGCGCCAAAGGCAGC
ACAGACCTCCGCAGCATCTTGGAGTCGTTTTGGCGAGTGTGGCCTCTGCAGCTCCTGGTCACCAGGCTTGATGTCGTACTTAAACGGGATTAGGCGCTTG
CGCAAACGGATTGCCGTGCCGAGTGAGAAAAAGCTCATGGTGTGCGCCTGGACGGTGCTCTGCTGGGGTGCGTCGGGGCTCTCGCTCGCCGCTGGCGCTC
ACGAGCTCGTGTACGATGCGTCAACCCGCGTTTTCGCCGATCTCCGCGGCCCTGTAGCGCCCTCGGGCGGCTCTGGTGCATGGGATATCGATGTGCTGCT
GGCCAACATGACGGTGCGCCAGAAGGCGGCGCAGATGACTCAAATGGACATTTATTCCATGATGGACGGGGACGAGAGAGACCCGAAGAAGGCTCTGAAG
CGAGAGGTGGTGGCACAATACGCGCGCGCGGGCGTGGGCTCCATCCTCAACAGCCCCTTCGCGGGAGGACCCGTCGGTGGCCGCTCGGGTTGGCGCGCGA
GTGAGTGGCGAGACGTGATCCAACAGATCCACCAGATCTACAAGGAGGAGGGCGTTGCGGTGCCCATACTCTACGGAGTGGATACGATCCATGGAGCCAC
GTACGTGCAGGGTGCGACGCTGTTCGGCCAGCCTATCAGTGCCGCCGCCTCGTTCAACCCCGAGTTGGTGTATCGCATGGGTGCCGTGGCTGCCAAAGAC
ACGCTGAGTGCCGGTATCCCGTGGATCTTTAGCCCCGTGCTGGGCATTGCAGTGCAGCCGAAGTGGTCTCGAGTGTACGAGACTTTCGGTGAAGATCCCT
TTGTGTCGTCCGTCATGGGAGCGGCGCTTGTAAAGGGACTACAGAGTTCAGGCAAGGTGGCGGCTTGCATGAAGCATTTTATCGGATACTCGAACGTCCG
TGAAGGATTGGACCGAGCTGACAATGTCATTACGGACTGGGAGCTTGTCAACTACTACGCCCCCTCGTTTCTCGCCGCCGTTCGCGCTGGTGTGCGCACA
GCAATGGAGAGTTACGTCTCGGTGAACGGCATCCCCGTGATTGCCAGCAAAAAGCTGCTGGTTGATTTGCTCCGGCATGATATGAACTTCACGGGGCTGC
TGGTTTCGGATTACAGTGAGGTCGATCGCATGTATTGGGAACACCATTTAGTACCAAGTGTCGCTGATGCTGTGCGCGTGACTCTGCAAGAAACCTCGCT
CGACATGAACATGTCACCGAACTTGCAGGCTTTCGGTGACACGATCGAGTCGCTGGTCGCCAATAAACTCATTTCAGAGAGCCGCCTAGACGAATCTGTG
CGACGCATTTTAGAAACCAAGCGAGATCTTGGACTGCTCGATGCAGACTATTATGATGCTTTCGAGCAGGATGATATGGGCGAGGATGGCAACGTCGGTA
GTGCCGCTGATCAGAAGGATGCACTGGCCTTGGCTCAAGAGTCCGTTATCTTACTGGAAAACCGCAAAAGTGCGCTCCCCATCGACCGCAAGACGAAGAC
AAATGTTTTCATCACGGGCCCTGTGTCAGACAACAAAGGCTTCCAATGCGGTGGGTGGTCCGTGTTTTGGCAAGGTTCCAGCGACTCAACGCTCTTTCCA
AACGGGGCCACTATCAAAGAAGCAGTGCAAGCCAAGGCGGCTGCTTCGGGGGGACAAGTCCAGGTTGAACATTTGGAGGTGGTCGATATTGATGGCAATG
TAAGCCCGCATGACTTTCAGCGGGGATTGCAACTTGCTGCCAAAAGCGAGTACACTATAGTCGCCTTGGGCGAACCCAACTACGCAGAAAAGACTGGTGA
CTTGCTTGGCAGTATGGCTCTCCCTGCTGGCCAATTATGGTACCTCGAGGAGCTCACCAAGCTAAATTCTACGAAGGTGATCGTCGTGGTTGTTTCTGGC
CGCCCTCGTTTGCTGGAAGGGGCCCACAATGAAGCTGATGCTGTTCTGTTGAGCATGTTACCGTGCGAGCAGGGCGGCCAAGCGCTTGCAGACGTGATTT
TTGGAGATGTGAACCCCTCCGCTCGTCTGCCCATTACTTATCCAGTGCGTGGTACGCAGCTATTGCCGTACTTTCATCGAGTGAACACGCGGTGCCAGCC
GTACGACGAGTGCCCCGTGCAGTGGGAATTCGGCCACGGGCTCAGCTACACAACATTCGAGTACACAGCGTTGCGACTCAACGCCACGCTTGTGCATGCC
ACCACTAGCGCGTTGGAGGTGGGAGTCACCGTGACGAACCGTGGCACCCGCTCGGGCAAAGAAGTTGTTCTGCTATTTGTCGCTCAGAAGTTTCGCCGAG
CCTCGGTGCCCGAAACCAAGTTGCTCAAGGCGTTCACGAAGGTCGGCGAGCTGGCGCCTGGTGCGAGCGAGAATATCAAGTTCGTGCTAACCCCCGAGGA
CTGGAGCTACTACGAGCCGCACGTCGTGGGGCAAGGTTTCCAGCTGAAATCCGAGCCCGGTGAGTTTGTTATTTCGCTACTTCCGTCGTCGACAGACAGT
GCGAGCATGGCGCCGCCATTTTCGTGGGGTTACAGCGGCAACAGATACAGCCAGGCTACAAACCGTGGCGGCCCCGACAGCATGGCACCGCCTTCACCGA
TCGGTTCCGATTCGCCTGCTGCACCGCCGAGCGTTTCCTTTTATGTGGTACCTTAGTGTCAATACAAGACGCTGTAGTGCAAGTGGAAACGGATGCCGTG
GGCATGCCAAGTCGGCGGCGATCGTGTCACAGCGTAGCGTAGCAGGGAACAGCATGAATCGCAAGAAACGAATTATGAACGCATGCCTTCTTATCCCAGC
GAAACCGGACAGACGTGGCCCAGCTAGTAGCTGGCAGATTAGACAGGGCTGCAGCCCTGTGTCGTGAGCGGAGACCACGACGCGCCTCACGTCGAGCAGC
ATTACAGGGCCTGGCTTGAGGGCCCGACTCCAGCATGAATGACAACTTCAACATGTGCTTGCCTCGCGTCCAACCACCGCTATAAATGCCATCGCGCTGC
TAAGCTTATCTTCTCCGTCCCCCCCCCTCATGCGAAGGAGACGGCGACAAGAACGGCGCCGTTGAGTGGAGGAAGATCTCCGTAAGTGGCCAAGCTGAAG
CATAGGCCATCTTCTCCGCCAACAGCACGCACAGGCATTTGCCAATTGCAGCAGCGTGAGCACAGCCAGTGGGGACGGAAAAGCTCCCATTCTTGGAGGT
GTCCAATCGCCGCTAACCTCGCCACAACCGCTTTTTGAGCGGCTCCGTTCAGCAGTACCGCCCGGACACACAAGCTCTCTGCAGGCCTTACCCAGCGCTG
ATCGCCAAGGTCGACAGCGGAAAACAGAAAGAAACGCCAGGCAACGGGCGAGGAAAGGCGCGGCAAGCCCGCTGGAATAGCGGAAGAAAGCACGGCATAA
AGCAATCTCCAGCTCACTAATATAGCTAACGGTCCCTTGGTGGCGAATAAGACAAGACACTTTGGGGGCTGCAAGCGCATCGACCACTTGTCAACTAACC
ACGAGAGAGAGAGACGAAGGAGGAGCATCCACCGTCTTTAGACCATCCATCCCCACCGACAGTAGCATGACACAACGAGAACTGTCGACGCTGATGGCGG
GCGCCACCGGGTACACTGAGGTTCAGCTCGTGGTTCTCGTGCTGAGCGTCGTGGTCGTGGCCGTGGCGTTGCTATCGTACTTCGTGGTCGCGCCTGAGTA
CGAGAAGCACCTGGACAAGCAGTACGCCGCCCTCGCGCACGCCTCCTCGGAGCGGCAGCTGCAGCACCAACAGGCGCACGAGCTGCTGCTCGCGCGAATC
CAGCTGCGTAAGCACAAGTCGCTCGGCGCGTGGGACATCGAGTCCGGCTCCAGCGACGACGACGGCCTGAGCCGCTGCGCGCTGCAGCGGCGGCACTCGC
ACGTGCGGCCCCCACCGGCCAGCGTCTCCTCGCCCCAGGATCTCGTTACAGAGGCAGCGCAGATCGCCCGCAGGGAGCGCAACGCCCGACGCCGCAAGAG
TGAGAGCGACGCGCTCAAGCAAGCCAACGTCCAGCGAGCAGACATGCTACGACGCCGCGTGCTGCTCCGCAAGCTGGAGGAGGAGATCGCCGGTACGGTG
AAGGCAAACGAGGAGGCGCAGGCCGCAGCGACGTCTAGCAACACCAACCCGAGTCTGGCTACTGTGCGACGGCTCTCGAGCAACACGCTCGAGCTCAGCG
ACGACCGCCTCAAGATGCTGCAGGAGCACCCGGCGGACTGCGTCGAGGAGCTCAAGGTGCTCGCCCGTGCTCAGTCGCCTACGGCGTTGTCTCCTTTGAT
CAACAACGCAGCCATGGCCAAGGGGAAGATCGACACCATGCCGGACCTCCACGAAATCAAACGAGCGCTGAAGGTGTTGCACGACGTGCTAAGCTTTTAC
CTGTCGGTGGACCACCGCGACATGAACAAGCTCACGGTGTTCTGCAACTCGCTGCTGCAACATGACGGCCTCAACCGCCTGCGCGCCTTCGAGGCGTCAC
GCGACCAAGACGTGCGAGCACTGTCCAACTCCATCATCGAGAAGGCTGTGCCTGCCATTTGGCATTAGGACCCGAGCAGCATCCGCCCACCTTATCTATG
AACCCCCCGCTTCCGACCCTGTAGAGAGAGCTCCAGCAGTGCACACCCCAACCACCCTAAGTAAATAGCTCCGTCGGAAGCTCGCACGCTTATCCAGGAA
AACTACCGTCTCATTTGCCTCTGTAATAAGCTCAGCAGCTTCAAAATTCATCCGTCTTCGCTAAAAAAAAAAAAGCTCATAAACTTGTCAACTATTTCTG
CTGGAAGGAAGACGCGATCTCTTGCAGCGAGCTGCTCAGCACCGTCCTGAGCACAAGGCGGGAGATGGACCCGCCACAGAGCAGCACACTGCCGGTCAGA
GACGGTGTGAGCTTGGAGTTCCACAGGATGAGCGTCTTGGGCTGCGAAGCGGGCGCCGTCGTGTCCGCCACGAACTGCACAAGCGCCACGTGGTCGCTCA
GTAGCAACGGACCACTCTTCTTGATGCTGTAGCGCACACTCGGAATCCTGTCGGAGCTGTCAGGCGGGCCCGCGGACAGAATCTGCTCCTCGACACCGAG
CGCCACGAGGCGGCGGTGGCCCACGAGACCGCGACCCTCGCCGGGCTTGAGCGTGGAACCGCGGCCGACCCACTCCATGCGTAGCCACGCGTCATAAGCC
TCGTCCACCGATGCGTTCACCAGTTGCGTGAGCGCCAGCTCTTGACCGTCGCTGTCGGCGTAAGCCTCGAAGCCGGCGGCATCGACGTACATGTTTCTCT
CCGACATGTTTGAAGAATGAAGCGATCCCGTGCGGAGATTGGCTGAAAAGGCGATATTTCGGCGAATAAGATAAAAGTATCTTTGTAACGGCTGCCTGCC
AGAAGCAACTTGATCGTAGATTGTCTCCAGTGGCGACAGAGGATCCCTTGGTGGCGCCAAGATTTTTATATTTCCTGGCCACTTCGAGCACTCGTGCGCA
GTAGCTTCGTGGAGTTGTCTGTATTTGCAAGCCAAAATGACGTTCTAGTTCTGCTACTCGAGATGCCGACCCGCTCTGGCAGCAGCACTTGCAGCCAGAC
CACCCAGCAAGCTCTGCAACGCCGAGCGCAGGATGAACTTGGTGAACCCGCCGCAGCAGAGCAGATAACCCAGAGCTGTGGGCTCCATCTTCAGCGACCA
GACCACGAGCGTGGCCGGCGTACTCTCCGGAGACGCTGCGACGTCCACGAACTGCACGAACGCGAGGTGGTTGTGTATCGGGAACAGACCGAACTTGTGC
ACCTTGTAGCATACTGACGGGATCTTGGAACAGTCTCGACGCGCTGCAGCAAGACTCGGTCGACCTCCGTCACTGTCCACCGGCTCATCAATAGGCAGTC
CGGATGATAGAATTTCCTCTTCAATGCCCAGTGGCATTTGCCGTACGTGGCCCACGTAGCCTCGCCCAACTCCTTCGTGCAGCTCCGCGCCTCCCGCCAT
CCAAACTTCCTCCAGCCACGCGTCGAACACCTCGGAGGGAGAGCCAATGACGCACTCGGACACCACCATCTCCTGGCCTCTTTGGAACTGGTAGTCTTCA
AAAGCCTGAGCGTCCACATACCGCGTCGGGTCCAAGTAACTGCGGCGCATTCTCCTTGCGCTTATCTAGACACTCGGAGAAAAGGCATCTCATTTGGTAC
ATGTATCCTGATATTTGGCCAATAGAAAGGGGGAGATGAGCATGAAGCTTTCTGGCTCGCGAGTATGGGGCCATTAGAGAGCTAACGCGCTCGCGGTCTT
CTTGGCTAAAGATCGCAAGAAACTTTTCAACGCGGTGCGGAAAACCAGTCGCACTAAACCGCCGCAGTGTAACCATTTGCAAGTGCTTGACATCTCCGTC
TTGACCGTCCAAACCACGAGCGTCGATGCTGTCCCTGCTCCCTCCTCAGAAATCGACTCAGCATTGATGAAGCTCACCATGGCGAGGTGACTTGCCAGCG
GGAACGGACCGGACTTGAGCACTCGGTAGCAAATGGACGGGATCCTGGGCTCGCCATCCTTGTCTTCAGCGACGACGTCTTCGTCGGGTTGTCCTGCCGA
TAAGATCTCCTCTTCGACGCCTAGCGGCACACGTCGGACGCTGCCAATGTATTCTCGGCCGGTGCCTTCGTGAAGTTGCTCCCCGCCTTCTAGCCAGACC
TCGCGAATCCACGCGTCGAAAACCTCGGGAGGAGAGCCCGTTACCAGCTCGGAGACGGTGAACTCCTGACCGGTGTGGCTGTTATAGGCCTCCAGTCCGA
GGGTGTCGATGTAGCAGCCGTTCACAGCCATCTCCATTGAAAGCGTATTTTGTATGCACCGTGAAACACAGTCAATGCTATTATGCTGGAGGGAAAGCAA
CGAAGATGATCTGAAAGTTGACCGCCGGCGTACAACCAGCATTGATTATTGAATGATCTAATGTATTTTATGACTTACTTCATTGTGGCGAGCTCTTGGC
AACGTGGTCGGCAATTCTTTCATATAATTTACAGTGTTTCCTTGAAAGCGTTGCGGTGGCGGCTGGCGTAGATTGTGCCGAAGACGGTAAGAGCGAATGT
GGCAACGCCCACTGCAATGCCAAGGACTACCCAGCTGTCCGGGGACATGCCGACAAACTCGACAGCACCACCACCGTCAACCAATGTGTGTGCAGGCCCA
GCTAATGCTCCCGTCGGAATGACGGGGAAGACGTTGAGGCCACAATTGAGTTTCGAGTCAATGGCGAGTCGAATGTATCCCTTCTCGCCCCAGGAGGATC
CGTACGAGTTCTTGATGATCCAATAGTCCGTAGTGCCGTCTGAGTCGTAGCCGACGAGCACCACAGCGTGATTGATGTCTGCGCTGGAAGCGAAGTCTCC
ATCATTTGGGCAACTGTAAATACCGCCCTTGTAGTCTTCGAACGTGCCGCCGGAGTTCAAGGCCACCGAGATAGGTTGATGTTGCAGTGCTAGCTTGAGC
AACTCGGTCGCGTCGCTGCTGTTGTCGCACGATGGCCCGACAACTTGCTCCCACCCAGCAATACTCGCAGCGGCATCGTCCGTAGTTGAGTTGTTGCAAG
CGTTTGCAAGAGTAGCGGAGGAAGCTTGCGACGTTTCCTCTTCGTTGTAGGGGAGATCCAGTTGGCTCAGCAGCGACCAATGCAATTGTGCCGCATCTGC
AAAGGCTGCATGGGTCATGCCTCCGTCGCAAGCGTTGTTGCTCGATCCCCAGATCATCTTGCTCTGCAACCAGCTCGATCCATCCACGCCGCCTTCTGCC
CAGCAGTAGTCGAACGTAGCCGTCATTTGCCTTGAGCTGCACTCCAAGAATTGCTGCGGCGACAAGGACTGCGGCGCAGTGCCCGCACTAATGACCACCG
CCGTCTCGATGGCATCCGCCGCTGCAAAAGCCCAGCAACTGCCGCATTGGTTCTGACTCTTGACATCAGTGCAGATACTGTGGTTGTGCGAATTGTCCGT
CGAACACCAATCCAGCGTCTCGCGGTATTCAAGTGTCGAGTTCGTCAGCCGGCGTTGTTCCGCCAGCCTGCGCGTCCACCGGCGTTCAGCGGCTTGGTGC
TCCTGCTGCACAAACTCCAAGGGCGACAAATGTCTCTTGCCATCGTGATACAAGTGGCGGGCGTTGACGCCCATTGCGTACGAGAAGGCCAGGTCTCGTC
CTGCCGCGTGCTTGTGCACCTGCTCGAGATACTCGATGTGGGTCTCCATCCGGCGTCGGAACTCGCTCGGGCCTTGGTCCATCCTTTCGTCCTGCAGGAA
CTGCGCCACCATGACGTCCGAGGGCACCGCGAGGCCGCTGCGATCCGCCCACAGACAGCGCGCGCCGTCGCAGCTCAGCAACGTGCCAAAGGTGGAAGGA
TCCTCTTGCGCCTGTGCCATCCACGGGGCGATGGCCGCTAGTGCCAGCCACTTCATTGCGCCCATGTTACAGGACTCGCTATTGGTGGCAGGTGGAGAAC
CACTTGGAGACTGCGTCCAGAGCAGGAAATGGCCGCTGCGTGGCCGAGTTGTGATTGTCTGATTGCGGCAAAACCGGTAATGACTACGCGAATGACAAAA
CCTGCAAGTCGAAGCCCAGTTTGCAATTGCGGTGAAGTGACTGGCTCACGACCATTTCCACATTGACGTTGACCAGGCTATTATAGGAGCGAAGCGCTTT
GGGAAGCGGTGTTGAACCAACTCAATTGAAGGATCCCAAAGCATGGGACGACGAAGGTGACCGCCAGCCGCCATCATGGTCGTCTGCCACGCTCCAGTGC
CGGACGAGAGACGCTGCAGCTGGCGTAGGGAGTCATCTGGATTTTTGCCTCGTTCAACAACCACATGAACTTCATGGAGAAGCACTAGTAAACCAGCCTG
GTTATGGCGAGAAGACTGGCTCGCTTCACATCTTTTTGGTGTTAGATCGTTTGGTCGGTCACCTTCTGTTGCACTTCAAACAGCTAAAACTGATTGCTTT
CATTCATCAAAATAGAGCCCCACGCCGGGTTTACTGTAATATCACCACCAACCCAACACATTGCCGCTCCTTAGTGCATGATCTGGGCGTTGGCGGCGTG
CATGGCCGAGTTCTGCTCTCGGATGGTCTTGATCTTCCGCTGCGAAACAACCATGCCGATGGCGGTAGTCACCAGTGTGAAGATGGTGGTCACGGCGGCC
ACGGCAATCCACGCCGTCGGGCTCAGACCCACGAAAACCTTGTCACCGCCACTGTCGACGCTGGTACTCGCCTGCGCACCGGCCTTCGCGCCGGTGGGGA
TAACCGGGAAGACGTTCAGCCCGCAGTTGATCTTGGAATCCGCTACCAGTTTCATATAGCCGCCAGCTCCCCACGAACTTCCGTACGAGTTCTTGAGGAT
CCAGTAGTCACCAACCGATGTGTCGGTGCCGTAGCCCACGAGCAACAACGCGTGGTTGAGATCGTTTTTCGACGCTATTTCGCCATCGTTAGGGCAGCTG
TAGAACCCACCAGCGTATTCTCCAAAGCCACCGTTCGAGGTGATCGCAACAGCAATAGGCTGCTTCTCCAGGGCGGAGCGCAGCAGCATAGTGCAGTTGC
TTGACGCAGAGCAGTCCACGCCCACGATCTGCTCCCAGCCAGTAATGCTGGCGGCTGCTTCATCTGCACTAACGGTGCACGCGGATGAATCGTTTGTCGC
TGATGATGTCCCTGAGCTCGAGTCGTCGTAAGGCATGGTGAGTTCCGTGACGAGCCCCCAACCATTCTGAGCCGCGTCCAGGAAAGCCCCGTGCGTCATA
CCACCATTGCAGCCGTCATTTTGCGATTCCCACCTGATCTGCGACTGCATCCAACTAGCACCATCCACGCCGCTGTCCGATGCCCAGCAGTAGTCAAATG
TCTGGGTCGTTTGCAGCGTGCTGCACGTCAAGAACTGCTGCGGTGAGAGGGAAACAGCACCCGACGAATTCTCTGCAATCACCACAGCGGTCTCGATCGC
ATCTGCAGCAACAAACGACCAACAACTTCCGCAGCTCTTTTGGCTTTTCACTGGCGAGCATACAGTGTAGCCGATCGAGTTGTCTGTATCGCACCAGTTC
CAGTACTCCGAGCTTCCTGAGCTCGACACCGTGCTGCTACTATTCGTCGAGCTGTTCGCCGCAGTCTGAAGGCGTCGCGAGTGTGCCGCAACCATCTCCT
GGTCCACGAACTGTTTTGGTGTCTGCCTTCGCTGAGATGACGAGGTTAAGTGGCGCTCGTTCACTCCCATGTGATACGAGAAGTCGTGGCCAACTTCTTT
CGCGTAAATGCTCACGTCTACATCATCACCACCAATACTCGTGTTAGCACTTAGCTGGGCATGGATGAAACTCAGACTGCCGCCACCGCACCTTCGATGT
AGGTCATGTGCTCCTGCAGGTTTCTCCGGTAAGATTCTCTGTCGCTGTAGGCCACGTAGTTGCGCTCGATGAACAGCTCACGCAGCGCGGGTGCGTCGAC
AACTTGTTCATGTTCGCTGGCCCAGAGGCACGGCGAGTCTGCAGAGCGAACGGTAGGACAGTCCACAAAGGCACCTAGCGATCGCTCCGTTGATTGCGTA
GCGGCAGCAACAGCAGCAGAAACCGCGAGGAGTGCTGCGTGAATCTGCATGGGTTCTGTGCTCGTTGTGGCAAAT