Description :
From Genome Similarity Track
Location :
Scaffold_23:375153- 379157
Sequence
4004 bases(100 bases per row)
TGCAGCGGCACTTCGAAGCTGCGATGAGTCGTTTCCTGGCCGAACAGGGTATGAGAGCGCCCGTGCCACAAGTGCAAGTGCTCCACGAACATGGAGCACG
AGACGTGGAAATGGAGTCAGTGGAGGGAGACAACTCCCATGATGAGTTCGACCCAGATGATCTGGATGGCCCATCCACTTCGTCAGCAGTGGTAGCAACA
GCCACAGCCGGGGCAGGTGGATCGTCCATGATCCAGAGGGTACGGATCTCAGCCATATCGGACCTGAAGGAGTTCACGGGCAAGGATCAAGATGAGGACC
GAGCGAGAACATGGATCAGCAAAGTCAAGTCGGCCCTAATGAGAGATCAAGCGTCGGATGCTGAGAAGTGTTTGACCTTTGCGGATCTGCTAGCGGGGCC
AGCCAGGAACTGGTATCGGCAGCTGGGCAGATCCACCAAGAACAAGTGGCCAGATTTGCTGCGCAGCTTCCAGACCCAGTACTGTGGATTGGGAGTGTCG
GTGGCACGACAATACTACCATGTTTCGCCGCAGATCGGATGAATCCCGCTGGAATACCTACATCGACTAAATGTGGGCCGGTCTACGTCCAAGTTGAAGA
TCAAGGATGGGGGATCCAAGGTACTGCGGGAACATGTGGATCACTTCATCGAGACGTTGGGAGATGTGGATCTGGCCGACAGGCTGACCCTGTTACGTCT
TCCAGACGCAGATGAGCTTGAGGAAGTGCTGCGGGCGGTGGATCGCGCGAAACACCGCCAGAAGAAGGCGGCGGTCGGATCCGGCAAGTATCACCAAAAG
GCTCCGACGCCCACGGCCCCAGCTCGACGTGTCCACCAAGTCACGGCACCTGACTCAGGAACTGAGTCAGGATCCGACGGTTCGGACTCCGACCCTGAAG
ATTACCGTCGAGTCTGTCTCACTGCGCCCAACGATCGAACGGCGAAGACCGGAGACAACTCTCGACCGGGGAATACCGTACCCGGGACCGTGGGATGTAC
AGATCCCGAGATATCATGGACGGGACAGCACAAGTCAGGGTGTTCGCAGTGCGAATCCCGGGAAGCACACTGGATCTGGATGCTGGAAACATCTGGTCTG
GTGAGAAGTGTGGCAAGAAAGGTCATCTCGGGGGATCATTGCTTCTACATTTCACGACGTCGGCAAGGTGTCCGATGGAGGAATTCTACACCAGATCCGC
CAATGGTTTGATCCAGCCAAGCACAGAGGGATGTTGCCAGAAGTGGCCGAGAAGATGCTAAACTAGGACGCTCGCCGGGTTGAATCCGGTACGAGCCGAG
CGTTCTAGGTATTGCATTTATGCATATCGGAACAAGACATCGCTAGATCCAGTCGATAATACACGTGATCTACATGAAGTGTCAGTTGCCAAGATTTCTA
GTTTGCGCCAAGTGGATGAGTTTGCGAGATCCAAAGTCTCTTCAACCCTGGATCTACAAAGGGGAGAAAGGCGCGAGGTTACTGGGAGAAGCGACAACAT
GGTCGATGGTTTGAGCCTACCAAGGGTGAGGTCACTGCAGATCCACCAAAGGTCTGTCAGGTCACTGGATCCCGTGGATCTGAGGATGTTAGATCCATGG
ATCTGCTAACAGGGGAGTCCCGTGGATACTGGAAGTACCATGCCCCAGGAAAGTGGTTCAGACAAGCCAAGGTAGGGGGCAAGATCAACAATGAAAAAGC
AATCCTACTCCTAGATAGTGGTGCCGAGGTGTCTTTACTGGATACCGCCTTTGCTCGTAAGGTTGGGTGCCAAGTGGATGGAAGTCGGATCCAAGATTGT
GTTGGGATTGGTGAAGGCGTGTACCGTACGAACGGGAGAACGCGAATCAAGATCACGTTGGCAGGTTGTTTGGTGTACTGGTTTGATATTTGAGTTGGCG
ATCTCGCTGGTCAAGACGCCATCCTCGGGATGGATTTCATGGTACCAGCCGGAGTGAGGGTTGGATCTGGCGGATGGGACACTGTGTTTCCTCGACGAGA
TGCGATCCGCTCGCGGACGGGAGCGTTTACGGGGGAAGATGGAGTATTTCTAGAGGGGCCGACACAAGAGCAACGAGTATTGGAACCGCGGGAGAAAACT
CGGGAATATCCACAATTCGTTGGAAATGGGGTGGAAACCAGAGAAAAATCGTGGTTTCTCTCGAGGGCGAAAAGAGGGGTGCCTTAACATATTCCCAGGG
AGCGAGTGCAAGACCCAGTTCGATCACAATACCTCCAGGTCACGAACGTCAGCGACAAGAGACTATTACTGGACCATTATGAGGAGATCGGGCGATGGCT
AGCGAAGGACGGTATCCCTAGGCGACCTGGATATGTGTCAGTGGGATCCCGTCGTTACAGAGAATAGCAGAATCTGGCGTACGAGGCGACTACCGAAATC
GAATCTCTCGGAGAGGTGGAGCTCCCGGTGGGACCAACTGGCCCCTTGGTGGATCGGCCTTCATATCCAACTCCGCGAAAGATCCTGCAGAGGGATCGTC
GGATTGAGGTCCAAGCGATGGAGGTTGGATCCAAGACCGGGGATGATCCCCAGAGTCGGCCCCTAGATAACGCAGGGTCGGTGGATGAAGGATCGCAGAA
GGCTGAAGCCGGACCGCCAGATCCCGCTGACCCCAGAGTGGACCCTAACTTTGCATGGGGCAAAGTGCCTGGATCCTTATCGAGAGTGACAACACTAGTC
AAACCAGAACCGTCGGGTTTAAACTCGCTAGAGGATCGACTAGATCCAACTGGTGGCTTCTCCGATACCAGGGTACCTGATCCCACGAAGACAGAAGGAC
TGCCAGGTAAAAGAGGGTCGCGGTGTATGGATCCAATGGCGGATCCGACGAAGACGGAAGATGAACAAGTCTGTTACCATGAAGGCGGGGATCTACACGC
CGAGGATCTCGGGGATGGCCTGGCGGTAATCCCGGAGGTGCCACTGACCACAGAGGAGGTCACAATTGACGATATCCAAGTGGATCCAGGGGCAAACGAG
CCCGCGGAAGTGGATCGGTTACGTCAGAAAATCTGGGAAAGCCGACATTTGCTGATTGGTAAAGGTAATGCATTACCGCCCGCCGCCCGCGGAGTCAAAT
GTGACATCAATGTCGGCGACGCGAAACCGATCGCTCAAAGGGTGCGGAAGGTGGCACCTCAGTTCCGAGAAAAACTATCAGATCTGATTAAGGGCCTGCT
GCAAGCCAAGATCATCAGTTTCTCGACATCCCCGTGGGCATCTCCGGTGGTAATCATCATCAAGAAGAACGGGGTGGTTATACGTCTGTGCATTGATTAC
CGGTTAGTTAACGGCCTGACTCGATTGATGGTGTATCCGATGCCTCTAATCAATGAGCTGTTGGAAGATTTGGATAAAGTACTCTGGTACTGTTCTCTAG
ACATGGCCAGTGGTTTCTGGGTGGTTACTATGACGGATCGAGCTTGCGCGATATCCGCATTCATCACACCGTTTGGACTGTTCGAGTGGAACCGGATGCC
GTTCGGATTGAAGAACGCACCCCAGATCTACCAACGCCTGATCGATAACGCCCTCTATGGATTCACCCGAATACCGGAGTCCGAAACAGGTGGGTCTGGG
GAAGGCCATACGGAAGTGGATCCATTCGAAGCGGGGGAGCCAGGGGATCCTGGGACCCCATCTGTGTTAGGACGCAGATCTTACATCGACGACATTCTGA
TTACGGCGGAATCGTGGGATCAGTTGTGCGAGAGAGTGACGTCCTTACTGGAGGCGTGTACTAAGTGGAATCTCTCTATTAGTGTGGTAAAGAGCTATTG
GGGGATGCGCAAGGTGGAGTACCTAGGCCATCGAGTTTCCAAGGAGGGATTGGAGGCGAATCCTAAGGACCTGTCTTCATTAGCCGATTTGTCCTTCCCA
CAGTCGTTACGGGCGATGCAATCTTTCTTGGGCAGTTTGAACAACTACAGTCGGTTCATCGAAGATTACGCCCTGTTTGCCGCGGTATTGTACGAATTGA
GAGA