Description :
From Genome Similarity Track
Location :
Scaffold_127:3751- 9722
Transcript NameFunction/comments
g11397.t1hypothetical protein
g11398.t1hypothetical protein

Sequence
5971 bases(100 bases per row)
ACAGCCTTCGGGCAGTCAGCCTGGAGCCGCTCGATCGGCTCCCATGAGTTCTGTGACGAGGGATACCCTCGCCACTTCACCAAGAGCTGGCGCTTCCTTT
GGCGGCGCCGCTCACGGAGCACACGCTCCACGTGGTAGTGGGTTTCCCCATTACGGTCGAGGAGGGCCGGCGGAGGCCTTGCTCGACTATGCGTACGAGG
CTCCGCCACAGCGTGAGGCTCCGAGATCGTCGGCGCGATCTCCCGATCGGTCCGTGCTGCTTCAGCAGCAGGAGATCCACGATCTCCGTGATCGAGTGTA
CACTCTGGAGATCGCATTGGGTCTCGGCCCTGGTGGGCAGGCTGCCGCTCAGTCGGGAAAGCCGGGGTCTCTTCCCCTCCTTCGTGGGGATGTGGACCGA
CTGAGCCAGGAGTGTGGGGATCTCCACTCCCGGGTCGATCGTCGTGCGTCGTCGTACGACGTCGACTGTCTTCGCGACGAGGTGGCTCACCTCCGTTCTG
AGATCCAGAACCGGCCGAGCTATCCGGGCTATCGGGAGCCGCAGTCCTATGCGTACTCCCAGCCGTACTACGGTTCCTACCCGTACGGCGGGGCGTTTTC
GAGGTCACACGCTTACGCCTACGACCAGTCCCCTGCGCCGGCTTCCGCGTGGCGGTCGCCACAGCGGGAGGCGGGCGCTCGGTTCGAGGTGGTGAACTCG
CCACCTCAGAATCCCCTTTCGCTTCCTGCGGGGGATCAGAAGCCTGAGGGTCGTGGTAGCGCTTCAGACGACCCACATAAAACGTCGGGTGGGTCGTCAT
CGACTTAGGCAAGTCGATCGTGTAGGCGGAGCCATGCCTGCTCAGGACCTCAAAGGGTCCGATAAACCTGTGCTTCAGCTTATTGCTGAGCACGGAACTG
ACCGAGTTTAGTGGTAGGTTCCTAGTGTCGAGTAAGACTAACTCGCCCACTTTAAACACGTTTAAGTTTCCTCTTCCATGTCGGTCAGAGTACTCCTTTT
GTTTATCTTGGGCGGCGGCCATTGTGTCACGCACCCGGCTTATCACATTAAGCCTGTTGTCGACAAAAGTCGACAACTGCTTCTTTAGGGAAGCCGGTGT
CACGTCTGACACCTGGGAGGAAAGAGCTTTCCGAGCCTCTCCCCCACTTACGACCGAAGCCGCGGTGTCACCACGGAGAGTGAGTGGCACCAGGGGGTTT
CGGAGCCCGTTGAGGTAGAACGGGGAGAACCCCGTGGACGCGTGTACCGCGTTGTTGAGTGCAAACTCAACCATCGGCAAACTGGCCGACCATGTGCCGG
GAGATTCGGCACAGACACTGCGTAGAGTGTCTTCTAGGACGCGATTGACGCGCTCCGTCTGGCCGTCCGTCTGCGGGTGGTCGGCCGTGGACATGAGCAG
CCGTGTTCCAAGCAATTGGAACAGCGTTTTCCAAAACGCAGACGTGAACCGTGGGTCACGGTCAGAGACAATAGTCTCAGGGAGGCCATGATAGCGGAAG
ACGCCATCCAGGAACAGCCGTGCAGTCTGTTCACCGGTGACTGAGTCAGCCACCGGAGCAAGGTGTACCATCTTGCTCAAGCGGCAGACAAACACCAGGA
TGCCGGTGTTGCCCTGGGCATCAGCCGGCAGTCCGAAGACGAAGTCAAGACTCATCGACTTCCAGCAGTCTTCCGGGACTGGCAGGCTCTGCAAAGGAGC
CGAGGCATGACCAGCAGGTTTCACTCGCTGGCATGTCTCGCAGGTCCTTACATACGTGGCGACCCACTTGTACATGTGGGCCCACCAGAAGACCTGGGAG
ACTGACAAGAAGGTCTTTTCGCGGCCAAGGTGGCCGCTGGAAGGCACATCATGCGCCTCCTGAAGTATGTCATACTTCACAGCCTCGTCGTTGGGGACGA
CTATCCGCGGAGGATCGGCCGGATCCACGCGGTAGTGGAGGAGGCCATCGACCCACGCATAGCGATGGAGGCGGGCACGATGGCGGGGCGTTAGCCATGC
ATGCTTGGCCTCCTTGCCAGCGGTGAGGAACCGCACGATGGGGAAGAGATTCTCATCATCTCGATACGCTAGCCGTATCCGATCGTACAGATCTGTCGTA
ACCCGACTAATGTGCGCGAGCTCATAGTCGGGTCGACGGGATAACGCGTCGGCAAGCACGTTCAGCTTGCCCGGCTTGTATTCGACGCGGAAGTTATATT
CCGCGAAGAATGACAGCCAGCGGGTCATCCTCTGAGACAGATGCGGAGAGTTGGTGGCCGTCCGCAAGGACGCGTGGTCTGTATAGATCACAACGGGCTC
AGAGCCCAGGAGGTGTACCCGGAACTTGACAAGGGCATACTTCATGGCGAGGAGCTCCTTGTCATGGACAGGGTAGTTCCTCTCGGCGGCTTTAAGCTGC
CTGGACTGGAACGAGATGACTCGCTCGTGCCCATCCGCGTCGTGTTGCAGCAGCGCGCAACCGATGGCATAGTCGGAGGCGTCGCAGACAACGCTGAACG
GTTTTGTCTCGTCCGGCAAAGCCAGGACCGGCGCGCGCTGCAAGCTCGCCTTGATGCTGTTGAATGCATCCTGATGACGGCTCTCCCAGCGCCAGTCGGC
ATCCTTCTTAAGGAGATCCGACAGGGGCCGTGCCAGCCCGGCATACCCCGCACTATACTTGTGCAAGTAGTTGGCGAGACCCAACCACTTGCGAAGATCC
TTTTGGGATCGTGGTGTGGGCCAGGCCGCAATGGCCTTGACCTTCTCAGGATCGGCTCGAACGCCGACGCTGCTGACGAAGCAGCCGAGAACTTTGATCT
CTTGTGCCGCAAAGACGCACTTGTCGATGTTGGCATAGAGCTTGTTTGCTCTCATGACCATAAACACTCGACGGAGGTGCTCGAGATGCACCTCGATAGC
CGTCTTGCCTTCCCCGGCACGGCTATGGACGAAGATATCGTCAAAGTACGTCTGCGTGAACGCACGCAAGGGTCTAAACAACTGTGTGACCAAGCGATTG
AAAGTCGCTGGGGCATTTGATAGGCCCTGTGGCATCACTAGCCACTCCCAGAGCATGCCACTCGGGGTGCTCACCGCCGTGAGCGGGATGTCGCGCTCGC
GCATCAGGATCTGGTAGTATCCATCCACCAGATCCAGCGCGCTATAATGCTCGCAGCCCGCCATGTTGTTCAACAACACATCCTTGCGGGGAATGGGTGT
CTGGGCGGGCACCGTTGCGCTGTTCAGCTTGTTATAAGCATGAACCAGACGCCACTTCCCGTTCGGCTTGCGAACGCAGAAGGTGGGCGTCGAGTGCGGA
GACTTCGACTCACGCACCATGCCTGCCTTTGCCTTCGCGGCGAAGAAGGCATCAATGACCTCGCACTGTTCGCGAGGCAGTGGCCATTGCCTGGTCACAC
AGTACTTTGTGCCTGGCACAAGATCAATCTCGTGCCTAACTCCTCGGTCAGGTGGGAGTTGGGACGGCGGGTCCTTGGACACCACGTCCGAGAACTCCTT
CACCAAAGGATACACTGGATCCTTGGGGTTCTCGAGGATCGCAGAGCCCGTGCGCGTTGCGCGCTTCTTGCCAAGCTCGTCCAGGACATCCTTGTCCATA
ACGGAAGAGGAGCTCAGCTCTTCTGGAGAGGCCTCCGGCTTCAGGAGCACCATCTCCGCGATTGCCTCGGCTTTCAGTTGTGCCAGGAAATCGTCCATCG
ACATTTCCTCGAGGTTCAGTAGCTCTGACACCTCAGGCAGGGCTGCCAACGTTGTGGAGCCCACCTTGACCGTACACCCGGTCTCGCCGTCGAAGAAGTG
ATAGCATTCTTCGGCCGGCCGTGCCTGAGGAGAGTTCTCTCTCTCCGAGTCGCTTGTAGCGACTCCAGTCTGTCTCACCAGACTCGGCTTACGGCGGCGA
CGACGTCGTCGATGCCCACCACGGCATGGTCCTTTGTTACCCACAGCCGGTGGTGACTCAAGGGTGGAGTCGGGAGTTCCATCGACTCCGTGTGGCACAT
TGTTACCCACACCAGAGGTGCTCCCAGCAACCTCGACCCTGGCCACGGTCTCGACCTCCTTGGTCTCACGTGGGCTCGTTGCCCTTGGGGAGTTGACTTT
CCCCGGCGTCGATAAGGCCGAAGGCCGTACGGTGCCATAGTCAGGAGCGGTGGGTACTGCTGTCATTGCAGTTCCCCTCGCTGGACTCGACGTCCTGTCC
ACCGGCATTGCCTGTGGCGGTCCGTTGCCCGCGGTGGACGGTGTCATGACACCTGTTGCGGCTCCTGCCGCAACTAATTCTTCGGAGTCATTTCCGACTC
GGCTCCGGTGGTAGGCCCGGCTGCTGACAGAGGTGGGAACATGACTCACCAATGCTCTGTCAGTAGCAGCAGGCCGGCTAGCCCCGATGGCTTTGCCGCG
CCAGTCTATCCAGGGCTCATGCTTCTCAAGCCATGGCATGCCCAGGATCAAGTCGTACTTGTCCATATCAAGAACGAGGAATCGTTCAGTGGAATTAAAG
TCCTCAAACTTGACGGACAGGTCCATAAAGACCTTGGGCACCTCCACTACAGTCCCGTCAGCCAGTCTGACTAGGACATGCCCGTTCCCTTTACTTTCTC
GTAAAGCATCGGTGAACTGGTCGCTCTTGCGAGCGACCGTCCGGCGGCGTGCAAAGTTCTTTGACGCCCCAGAATCGATCAAGATTCTCATGGGATGATC
GTATCCCCGTACACTTGCATGTACTACAAGCAGCCCTCCGCTGCCCTTCTCCGCTTCGAGAGTACAGAGACTCTCAGGGGCTAAGCCTTCATGGTGCGCA
CCACCCGCGCACCACTCATGAAGACTTAGATCTTCCCCAGTAGGGCGCCCCGCCCCTACTGGTTCCCTGCGTTCCCCTGGCCACGGGGTCGCGGCTTTTG
CCAGCGACCCCTAGGACCAAAGGGCTTGGGAGGAAACCGCCGTGTTGTTCCTCCCGCGGGGCACGCACGTTTCATGTGCCCCAGTTTGCCACAGCCGAAA
CAGCGAATTTCGTGCTGTTCGGCAAGGCTTAGGTCCATCGGCACAGGACCGTTGAAGGGGCCTCTACTTTGGGGCCCGCCCTGAGTGGAGCCTCCAAGCC
ACGCAGTGGCAGGAGTGCGAGCCTGTCGATGGCTGTACTCCTCCTGAAGAGCGATTTGAATCGCTTCTTCCAGGGTGCTTGCTTGCACCCGAAACAGCTG
CGTGCGCGCTGGGCCTACTCGCAGGCCGTCCATGAACACCGTCACCTTGATGTGTTCATGGAGTGGGTTTCCCACCAGAGATGCGGTGAGCTCCCGCATC
TCCTGGATGTACTCGTGCAGCTCACGTCTCCCTTGCTTGCACGCAAGGAAGCGTGAGCGCTGGCGATACTCATAGTTCGCCGGGAGGAAGGCGGCTCGAA
GCTGTTCACACAGCTGAGCCCAGGATGCAAAGCATCCAGGCGTTGTCGCTTCACGCGTATACGCCCAGCTCTTTGCTCGACCACTAAGGTGGGGAGAGCA
AAGCGACGCGGAGTCGCTCTCCGAGACGAGAGCCGCGTCCATAGCGAGCTCGACCTCTCGGACCCAGAAGTGAAGGTTTTCCCCTTCCTTCCCTTCGTAG
GGGTTAACCTTCAGCCTCAAAGGCTTGGGCTGAACTGGTTTCCGTTCAGCCACAGGGGCCTGTAGGCTCCCACGTACATGGGCGATTAGCCCTTGCTCGT
ACGTGTCGAAAGCGCTTACGCGCTCGAGCTGCTCGGCAGGTGTTGCTGCCGCCAAGCTCTGGAGGGCATCCATCCCGAAGATGCCCGCCATCTTCCGAAC
GGACTCGAACTGCGAGTCGTTCAAGTGAGGAAACTCACTGCGATCCATGGTGGCTCAATGCTTGAGACCACAGAGGATTCAGGTAGTCCAATCTTACCCG
CGTAGGCGAGGATTGACTACAAGTGCTACCAAGTGTGACGGGAGTCACACAGCACCTTGCGCTGGAGGAAG