Description :
From Genome Similarity Track
Location :
Scaffold_80:37502- 38741
Transcript NameFunction/comments
Pytir_DAOMBR486snap-pir_contig_80-abinit-gene-0.105Dual specificity mitogen-activated protein kinase kinase

Sequence
1239 bases(100 bases per row)
TAATCCACCAACTCGCGAACGAATTTGCCCTGGAAGACAAGCGTGCAGTTCCTGTACAGTCGAACCAACACAATAGCAGCAGCAGTAGCTCAACACAGCG
CGAGACGCCAGCTCCTCTAGCGTCATCATTGTCGAAGCGCCCCCAGCTTCGGCTAAAGCTAGAAGACATGCCCACACCCCAGCAAGCAGAAGACCGAGCG
CAGCGTGCTGCGAATCGGTTAATCGCGAAACGAGAGGCAATGGAGAAAGCCATGGAGGCTTCTGCAGCTTCCGGAGTTGCAAGCCCTGGCGTCAAAGCGA
GTGCAACCCAGAATGCGATTCTTCGATTGAATTTCAAGTCATACAGCTCTGGAGATGATTCTGACGTGCAATCTCCAAGTGGTACGATATCTTTTTATCC
ATTTGGGACGCATCGTGGTTTGCTTCAATTCATTGTCAATGTACTTCGGCTTGGTGAACTGTAGATGCCGGACGCCGAAGTGCTGGTAGCGCGTACTCTC
CGAACCATGGCATGTTTACGACAAAGAGTGTTGCAGTATCGGAAGCCGGGATTTCTTCCCCGGATGCAGCTTGCTTGCATTTGCAGGAGAATCTGGAGAA
AGTGCGAGAGGTTGGACGCGGAGCATCTGGGATCGTGTACAAGGCTATTCACATCCCAACGTTGAAAGTTGTAGCGATCAAGGTGAGCTTTTGCCTATGT
ATTCAAGCAGGACATATTCGCAAATATCTAACCTTCGAATTGTTGGGGGCAGGATGTTCCTGTTTACGGGAGAGGTCAACGAAGGCAAATGGTTCGCGAG
CTCCATGCGCTGTATTCGAATCTTGTGCCAATCAGTGAGAATGAGAGTCCAGGACAGCCCGGCAGCGCTCAAGCAGCATCTAGATCAACGTGAGTGAAAA
AATGGGTTCTGTAAAGCCATGCATATTGCTAACGTGATTGGTGGTCTTGCTGTTGTTGTAGACCGAGCCCGTACATCGTTTCGTTTTATGACGCGTTTGT
CGATCGCCCGAAGAACTCGATTTGCTTGGTGATGGAGTACATGAGCACCGGATCTCTTCAAGATATAGTTTTGCGTGGCGGGTGCCAAAACGAGAAGATA
CTGGCACGACTAGCGGTGGGCGTACTCCGCGGTCTAGCTCACATCCACAAGAAGCACATGATTCACCGAGACATCAAGCCGCACAACCTGTTGACAAACC
GTCAAGGAGAGGTGAAGATTTCCGACTTTGGCCTCGCAA