Description :
From Genome Similarity Track
Location :
Scaffold_189:3750- 7523
Sequence
3773 bases(100 bases per row)
CCCATTACACCTGGTAGCACTTTGTAGTCCGTCCAACGACCATAAAAATATTGGATGATGAAGGGATAACTTCGATACCACGCATGAAAGCTACTCTCAT
TTGAGTCAAATCGAATGGTATGTCGTCCAACGTTTGAGCTCGACGATAGGGCAAGAAGCCGTCGGCGCAATGCTGTCCTCTTTGGGGTCAGACGGACAAC
ACGCCACCATTGCCAAGGTCATCCAGAATGAACTTGATGCTGAACGGGAAAAAGTAACCTTGCCTTACCAACATTGTTCTCAACAGACGAAGCCGTTGAG
AGAACAGAGCGCTCAACAGTTTAAACTGTTGAGACAGCAGCATGCCGCTGCTACCGGGTCAACACACACACGTCGACCCGGAACATTGAAGATTGACATC
TTCAAGTACAAGGGAGACGATGAAGACTCCCTGTTGATATGGTTTGCGGAGCTGGACGATGCCATAAGGGCTCGTCACATAGTCGATGAGCACATGCAGG
TCGCATTGACTCAATCGAATTGGCAGGACGTGCGAAGACTTGGGCCTTAGGCATCAAGCTACACGATCCATATCTCTTTGAGTCGTTAGAAGTCTTCAAA
TTCCGGCTCAGACAAACATTCGAACCACCGCGAGCTGACTTCAGGGTTCACTCTGAACTCCTGAAACACAGGCTAGGCAAACGTGATGTACACTCGTACA
TTCAGTACATACGTCAACTTACGAGTTGCAGTACAGCAAATACGATGAATGAACAAACGTTGATCACGTTGTTCATGCAGGGTCTCACGGACGGTCCAGT
CAAAACCTAACTGTTACAACTGGAATTTTATACCCTGGAAGAGGCAATCCGGGTTGCGGAACAAGAAGATTTCAGTGTGAAACAAGCTCACGTGAATTCG
AATCCCTATTGTCTCCCGAGACGACGGGAAAGTGGAGGCCCAGAGCCAATGGACGTCTCTTACGCTGAGAGTGAAAGCTCTTGCATTACCAATTATACGA
AATTGCGGACATGCAATAGCTGTCAAAAGCCAGGGCATTACGCATATGAATGCAGTTCCCCGAACGCGGTACGACATACCGCAGGAAACAGTAACCATCA
AGCGGCCAAGAAGGGTCCAAGACGTGGGTCCGACGCTGTTGCGAAAGGGTAACACCGTAACGGACAGCCAAAAACGGTCAGGGTCAGTAGGTGCGGAGCA
GACCCGGCAACGTCAAGTGAATTCGCACGCCTCTTGACGAGAGTCGCCCGCAACACGCAAATATTGTGTGTTACTGCATGTGGTAATGAGGTTTTCCTCA
TTACCACGAAGCTCGAAGTGGCAAAATACATGTCACTTCGAGCCCTAGTCGATTGTGAGGTGTCGAACAACTTTGTTGGGCGCCAGTCTCTAGACAATAG
CAAGCTTAAATTTATTGAGCGCGAGATCCCTCCAACGAGGATAACGGTACGCCTCGCTACAGGCGCATCCGCAACAATGATGGAACGTGTAGTGAAAGTT
ACCTATACACTGAAAGAAGTCCAATGTAATGGTGACCTCATCGTATTGGACTTGGATACAAGTTTGATGTCATCCTTGGTTTACCGTGGCTCAGAAGGTA
CGAGCCACAATTCAGCTGGCATTGATGAAAAGTCGATATGCCTGTCGCTTCTTCACCAGATGGTCGTCTGATAAACGTCATGTAGCGCCCACTAGCATGT
GGGTGTACTACGGGTGAGTGTGATGGCCTCACGTGTGGTTTGGTCGTTAGTACGACTGCACATGACCACAATATGACTGATCATCACACGGTGGAGCAAG
ATTCCGGCGTTTGTGTAGATACGCAAGTAGCGCCGAAGGCCCACCACCCGAATAAGCCGAGCGGACCGGAGCATGGAGTTTATCAAACGGTCAACACCCA
AGCAACATTAAACCGATTGCCAATGATTCGCAATACGATGATCTTGAATCGATTGGAAAATCGAACGTAGAAGACCTGGCTGCAGTACCGCAACCACCGC
CAGAAGACTTTCAGGGAATAAGTCCACTAGTACGTGATGATCATATAGCCCAAGAGGCTAGTGAGAGAATAAGTCCTCAACCAACTGTGGAAAACAATTA
TAAGAAGACAACAGAGACATTAAATGTCCTGGTCAATGACGGATCAAGTATAGGTACCTAAACAATTGATCTAATCGCGCCTCCAAAGTCAACTTCGGAG
ATCGCTAAATTGCCCACCCTAGGACAGAAGAGGTTCTTGCGTGATCTTCTTAGTGGCAAATCCAAGCAGATCTGCGTACTCGTCCCATAGGACGAGTATG
TCACCGATATCCGGTCGGTAATGGTCTTTGCCGAGAATGAAGAGTTCTCAGCAGCTCATGAATGGACGAGAGTGTCCTTGATGAGAAGACACGAATTGAG
CGATATACATCTCAGCCCGTGGGAATCGCTCCGAACAAATTCTCCCTACGATGATTAGATTGAACCTAGGGATGCTTTCCCGGAAGTAGTGCCGTGCGAG
CTACCGAAGGATAAGGGTACTCGTCACGCGATCGGCCTGACACCAGGGGCCGAAGCAGTGTGTCATAAAGCAGTTGTCAATGCCCTGCAAATAAGTACTA
GTGGTCGACAAATCTTTTTTGCCGATTGTTCAGCAGCGGGTCATGTGAGGGAGTCAACCCCCCCCCACGTATCTCTCCGACCTTTTGTGTGCGAAAGGCC
ACAGGAGGGTGGCGGATAGTACACGCCTTCAACAAGATGAATACTGCCACTTTACCGGCTCAAACACCAATACCAAGGAAAGATGTCATCATAGATGGTA
TGGCTAAGAGTACCATCTTTTCATCCATGGATCTGATGGATAGGTTCTATCAGATCCTTATGCCGGAAAGAGACATTCCCTGTACTGCAGTGAGCACCTA
AAGCGGTATTCATTGGGAGTGGTTAGTAATGCCACAAGGGATAAGTAATGTACCTGCCACATTCAATAGATGTGTAAAGAATCTATTAAGATCCGTAAGA
GAGTTCGCGCCCAGCTACTTCGATGATGTGTTCGTCCATAGCCGGGCTATGGATGGAAAGACGGATGTGGAAGTGCACCGACTCCACGTCCGGAAAGTTC
TTACACTAATGCGCGAGCATAAGTTATACGCACACCTCAAAAGGTGTATATTTGGTGCTAGCGAAATACCACTTCTTGGGTCGTGCATCGTGGGCAAGCA
TGGCGTCCGGCCCGATACAGAAAAGATCAAGGCGATCACCGACTGGCCGGTGCCTACAGAAGTCAAGGGACTTTGAAAGCTCTTTGGCCTAGCGGCGTAT
TTGCATAAATATTCACACAATTACGCCGAGATGACTGTTCATCTCTCTCGTTGATTAAATTAGAAAAAAAGAGAAGTGGGTATGGAGTGCTGATTGTCAG
CGCTCCTTCGAAGGTATCAAGCAGAGCTTGATACGATCGCCAGTTTTGTCGATTGCAGATCAAGACAGACCATTCCACAAGTCGGTGACACCAGTGACTT
CGCAATCGGCTGTGCATGAAGGCAGTACGATGCAGACGATGTGGCACGTGTCGTCTGTTACCAGTCGCGTCAGCTGCAAGCAGCCAAGCGCAATTACCCA
CTACGTGACAAGGAATTTCTTGCCATGAAATATGCACTGGCTATATTTCGCGACTATCCCCTAGAAGGTAGACCGTGTGTAGTCTATACGGACCTTACGT
TATTACGCACGGCCGTAAACAGTCAACACCACTCTTAAAGTATGTCGAGATGGCTGTCCTTCTTCGCGTAGTA