Description :
From Genome Similarity Track
Location :
Scaffold_527:3750- 4786
Transcript NameFunction/comments
g13668.t1ETK80870.1 hypothetical protein L915_13570 [Phytophthora parasitica
g13669.t1XP_008909379.1 hypothetical protein PPTG_14144 [Phytophthora parasitica INRA-310

Sequence
1036 bases(100 bases per row)
CCGACATGTTCAATGCTGCAGAGGGTGACGGCGAGCCTCTGGCTTATCCGGCGTTGGTCGCAGGTACTGACCAGCGGAGGATCCTCGACGAGCTGCAAGC
AGTGGGGTTTAAAGACTTGAAGGCGTACCGCACGACGCACACCATTGTGTTCGATGACCCCAAGGCCATGGTGCAAGCCAACTTGAACAACCCGTTTACC
GCCAAGTTCTTGGAGAGGTTGACGAAGGAGCAGATTGTGGAGACGCTGACCAAGTTGCTGGACCAGGACGGCCAAGAGAACTTCCACCAAGAGGGAGCGG
TCTCTGCCTTGGACAGTGCGGACCCCTTTGCGGATGGACGTCCGTGCTTGATCCCGTTTACAGCGTACACCATCCTGGCACGCAAGTGAGCTGGCTTTCG
ACTGCGGGGTCTTTTGCCACGGCTCGAGTAGCCTAGTCTCCATGTTGCTTGATAATGCCAGCGTCAAAGTCTTTTACTCGTGTCAAAGTTAAATAAGTTT
CAAACCGGTGCACTTCTTCCACATAGCAGAATCGCGGTTCAGTTTGCACCCGTGCCTTTCGTTGCCTCATGTTCGACGAAGCTGCTCCAAGAAGGCACTC
ACCTCGAAAATGCAACGTATTGATGGCTCTGAGAGGTGTGAGGGAGATATCAAGCAAGAGCGGACACAAGACGACAGTATTTGTAATGTCTTGACAGGGA
TCAAGACAGTCGGCGCGAGTTATTCAGAGAACGTCTATCGCCTCTGAGTGGAATCGCGATCGAGTCGGAGAGATGCGCCTGGTGGAGCTACAATTCTGCT
GGCGACGTCCTTGTTCGTGCCGACTCACCTGTTGCTGTCAGTTCATCACGTCGAGATTAACCACCTGGACGCACAACAGCTATGCTGCCTTCGCAGTTTC
TTGAGTCTCTCGTCACGATCATCGGGTTCATCCTGCAAATATCAACGATTCTCGCGACGGAAGACAGCTCGAACGACCTCGTGCGCTCATATTACCAGAT
CTACTGGTACTCTCAGCTTACCAGCAATGCCGAAAC