Description :
From Genome Similarity Track
Location :
Scaffold_162:375- 2360
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_162-fgenesh-gene-0.0Pre-mRNA-splicing factor ATP-dependent RNA helicase PRP43

Sequence
1985 bases(100 bases per row)
AGCACTAGCACCAGTAGCGGCAGCGGCGGCGTCAACCCACTCACGGGCAGAACGTACTCGGCGCACTACCAGAAGCTGCTTGCGCAACGCCAGAAGCTGC
CGGTGTACGGCTTCCTGACCGAGATCCAGGATGCGATCAAGTCGCACCAGGTGATCGTCATCGAAGGAGAGACGGGCAGTGGCAAGACCACGCAGATCCC
GCAGTTCCTGACCAACATGGAGATCCCCGGCGCGTCACCAGCCGCCAAGATGGTCGCGTGTACGCAGCCGCGTCGCGTGGCTGCGATGAGCATCGCCAAG
CGTGTCGCGGAAGAGATGGACGTGGAGCTGGGACAAGAAGTCGGTTATACCATTCGTTTCGAAGATGTGACGTCCGCGAAGACCAAGCTGCGGTTCTTGA
CCGATGGTATGCTGCTGCAGCACGCGATGAGCGACCCGTTGCTCTCGCAGTACTCGGTGATCCTGCTTGATGAAGCCCACGAGCGCACGCTAAGCACCGA
TATCCTGTTCGGTTTGCTCAAGGAGGTAATGCCAAAGCGCCCAGACCTGAAGGTCGTCGTGATGAGTGCGACGCTTGATGCCAAGAAGTTCCAGGCGTAC
TTTGAAGGCGCTCCGCTGATCGCGATCCCAGGCCGTACTTTCCCAGTCGACATCTTCTTTACGCCTTCACCAGAACGCGATTACCTGGAAGCCGCGGTGC
GCACTGCGGTGCAGATCCACATCTGCGAAGATGAGGGCGACATTCTGCTCTTCCTCACAGGTCAGCAAGAGATCGAGAAGGCGTGCGCACAGATTCAGGC
CGAAGCCGACGCGCTGGATCAGTCCAAGTACGGTCCACTCGCTGTGTACCCGCTGTACTCGACGCTTCCTCCAAACCAACAGCAGCTCATCTTCAAGGAA
GCGCCAAAGCCGCGTTTTCCAGGTGGACCTCCAGGCCGAAAGATTGTGGTGTCGACCAACATTGCGGAAACCTCGCTGACGATTGACGGCATCGTGTACG
TGATCGACCCGGGCTTCTCGAAGCAGAAGGTGTACAACCCGCGTATCCGTGTCGAATCGCTGCTCGTGTCTCCGATTTCCCGCGCGTCTGCCAAACAGCG
ATCTGGTCGTGCCGGTCGTACTCGTCCAGGCAAGTGCTTCCGCTTGTATACGGAGCAGTCGTTCCTGCGCGACTTGGAAGAGCAGACGTACCCAGAAATC
CTCTGTTCGGAGATGAGTGGCGTCGTGCTCACGTTGAAGCAACTGGGGATCGACGACCTGGTCCATTTCGACTTCATGGACCCGCCTGCTCCAGAGACGC
TGATGCGAGCGTTAGAGATGCTGAACTACCTGGGTGCGTTGGACGACGAAGGCGACTTGACCCCGATGGGCAAGATCATGGCGATGCTTCCAGTGCACCC
TCAGTTGGCGAAGATGCTCATCTCGTCGGCGGAGTACAAGGTTCCACAGGAAGTGGCGACGCTCGTCGCCATGCTGTCTAGTCCTGAGCCTTTCGTCCGA
CCAAAGAACGACGGCAAGGCTGCTGATGAAGCCAAGGCGAACTTTTCCCACGTCGACGGCGACCACCTGACGCTGCTGAATGTCTTCCACGCGTACAAGC
TGAACAACAGCGATCCAAACTGGTGCTACGAGAACTTTCTGAACCACCGTTCGCTGGCGTCTGCTTCGAACGTCCGCGACCAGCTGATCCGCAACATGAA
GCGCCTCGAAATGCCGACCCAGTCGTCGATTGACATCCACTCGCCAGACTACTACGGCAACATTATTCAGGCGCTGGTTTCCGGGTTCTTCATGCAGGTC
GGGTACAAGGCCAGCGGCGGCCACTACGTGACGGTCAAGGATAACCAGGTGGTGCACCTGCATCCTTCGTGCGTGCTCGACGACAAGCCTGAGTGGGTAC
TCTACAATGAGTTTGTGCTTACAAGTCGCAACTACATCCGTCTGAACACAAGAATCCGTGGCGAGTGGCTCGTGAACCTCGCGCC