Description :
From Genome Similarity Track
Location :
Scaffold_4:374933- 381383
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G002050Similar to mug71: Meiotically up-regulated gene 71 protein (Schizosaccharomyces pombe)
Pytul_DAOMBR144PYU1_G002049Similar to FIP1: Pre-mRNA polyadenylation factor FIP1 (Debaryomyces hansenii)
Pytul_DAOMBR144PYU1_G002048Similar to rpl21a: 60S ribosomal protein L21-A (Schizosaccharomyces pombe)

Sequence
6450 bases(100 bases per row)
ATGAAGGTGGTCGCGCTCGTGAGCGGCGGCAAGGACTCGTGCTACGCCATGATGGAGTGTGTGCGCTACGGCCACGACATCGCGTGTCTTGCGCACCTGC
ACCCGCCGCTCGAGCTGGCGCCCGAGGACACCGAGATCGACTCGTTCATGTACCAATCTGTGGGTCACAACGTCGTGGCGCTCATCGCCGAGAGCATGGA
GCTGCCGCTCGTGACGCAGACCATCACGGGCACGGCCATCAAGCAGGACATTGACTACCATGTCACGACCGATGGCGACGAAGTGGAAGATCTCTACCGC
TTGCTCAAGAAAGTGCTGGTCAGTAGCAGGTGGAGTAAGTGATGAAAAGTCAAGCGATGGACGCTCTTGCTAACCGTTCGATATCATGTAGGCCGATTAT
CCTGAGGTGGAAGCCGTTTGCACGGGTGCAATCTTCTCGTCGTATCAGCGAAACCGCGTGGAAAATGTGTGAGTGCAAGGCGATACAATGCACTAATTGT
GCTCTTGTGCACGCTGTGGGGCTAATGTGTTGATACGTGTATATACCTTTAGCTGCTCGCGACTTGGTCTGACATCGCTGGGGTACCTGTGGCGGCGTGA
GCAGGAGGATCTGTTGGATGATATGATTGAATCCGGGATCGAGGCGATTCTCGTGAAAGTCGCGTCCATCGGACTCACGCCTCGCAAGCACCTCGGCAAG
ACCATCGAGGAGCTCCAACAGGATTTCCTGGCACTGGTTCGTTTCAAACATGGAATATATCGTGGTGGTGATAGCCTCACACTGTGTTTGAATCCCAGCT
GATGGTTTAATCCTGTTTACTCATATTATGCAGCAAGAGAAGTACCAGCTGAACGTATGTGGCGAAGGTGGGGAGTACGAGACGCTCACTTTGGATTGTC
CATTGTTCAAAATGAGAATTGTCATGTACGTGGGCAAAAAATGAGGCTCTACTTGTTTATTTGTGGAACAGAGAACTGACGTATATCTATGTGATAAATC
TGTCTTTCGTAGTGACTCGTCTCGCGTCGTGCTCCATTCTGACGACTACTTTGCGCCCGTGGCGTTTCTCGTGATCGAAAAGTGCCACCTCGAAGACAAG
GAACCCGCGAGTCCTTCGAAGCTTGCACCACGACTCCCGATCTCCTCTTTCGTACCAGATTTGACACGCAGCGTTCAGGAAAAGCTGCAAAAATCTGGTA
CAACTAGCGCTATAGCGCTTGCTCAGACGACTCAAGCGGATCGTGCATTCCTTCCAGCGCATCATCAATTCCGCAATCTCTTCCACTTGAGCGGATTCAT
GTGCTCAAACAGTGCATCCCTCACGCTTGAGCAGGAAATCAAAGAGATCTTTGACCATGCCAAAGGTAAGATGACTGGCGAATTCTGCTAATGCGTAGAG
AGGCCCTATGCTCTATCTAAGCCTTTTGACGCTGGACTCATCCTATTCTATTTTGTGCCACACAGACACACTGGCTAAGGAATCCATGACGCTGGAAGAT
GTCTGCTTTGTGCATCTCTACGTCCAAGACATGAACCAGTTTGGCCAAATTAACGCCGAGTACTGCAAGTACTTTGGTGCGCACATGCCGCCATCGCGCA
GTTGCGTCGAAGTCGGGTCGCTGCCAGCTCGCGTGCTCATGGATTGCATCGGGATCCGCGGCAGTGGCGAAAGCAAACTGCGTCAATCATCACGTGTGAC
GCGCGATGTGCTGCACGTCAAAAGCATATCAACATGGGCGCCAAACTGCATTGGGCCGTACAGCCAAGCGAACATTTTGCACAAGTCGCTCATCCTCTTG
GCGGGCCAAGTCTCGTTTCTGCCGCAGACGATGGAGATCGTTGGCACCGACCATTTCGCTCAGGCCAAGCAGTGCTATCGCAACGCAGGAAAGGTGCTTG
AATCGCTCGAGTCCAACTTGCGCCACATCTGCTCGGCGGTTGTGTACACGACTGCCATGGATGCTAGTAGATCGACTGTCACTGACCTGACGCAGGTCTG
TCGCGCGCAAATGGTGTCGAATGCTGGATTGAAGGACCGATTCGAAGACGTTGTCGACAGCGATGAGAGCGACGACGAGGTCGACAAGGACCAAGAACGC
GTTGCGTTAGTCACTAAGGCGCCGCTGCTAGTGATCCAGGTCTCCCACTTGCCTCGCCACGCTCTCGTCGAAGTGGAGCTGCAAGCGTTCTGTCATCGCG
TGCTCAAGCACCTAAGTCCAGTCAGCTCGGCGTTCAATCTCAATAACCAAAGCGAGAGCAGTGGATGGGAGTTCGAATGCCAAACGAGCATAATCCCGCG
TGCAGTGAGTCTGATCGTGTGCACGGCCACGCTGTCATCGCCTTCAAAGCAAGTCCTTGATACAGATCACGTGTACCAGAGCGCACTCGGTCTCGTCAAG
TGCATTGAGAAAAGCCTGACGAACGCGCAGCTCCCATGGGACCGCGTGCTGCATTTTCGCGTCTTTTACCAAACGGCTGCGTTCCAAAGCGAAGTTGGCA
TCGCCTCAGGTACGTTTATCTCCACGCCTCTGCTTGTGTATTTCACGTTGTCTTATTATGGTTTGTGTGTTTGTAGCTTTTCGTGATGCGATCGCAGCGA
TGTGTCAGCATCCATCGGCTACGGACAGAGCATTGCCTGCGATGACGTTTGTTCCAACCGAGACGATCCAAAGTAACGCGCTGCTTGCAGTTAAAGTGAC
GGCGCACGATTTAGATAAATTAGAGACGGAATTATGGCTCCGCAAGCAAATCTAAAAGAGAGGAACTGGTGCTGTGTGCGCTAGTGTCGCTACTGCGTTC
TGTGAACACCTAGCGTCTTCGTTTATATCTCTGGTCGTTGCTGTTGCTGCTCGAACCTCCTCCGCCGCCATTACTTTCATCACGGTCTCGGCGCTTACGA
GGGTCTCGGTCGTCCGAGCGGGGGCCACCTCGACTGTCGCGGTCTCGCCCCTTGCTGTCCTTGTCCTGTTCCCCTCTATCACGATCGCCGCGGCGTTCAC
GGTCTCGGTCGCGACTACCTCGGCCTCTGTCTCGATCGTTCCGGTCCCGATCTCCTCGGTCGTTCCGGTGGTCTCGGTCGCGGTCATTCCGGTCACGGTC
ACGACCTCCTCGGTCTCGATCTCCTCGTCCGTCTCCACCGGAATCCTTGATTCCATCACGACCATCACGACCATCACGACCATCACGACCAGAGCTCTTC
GATGTATCTCGAGACGAGTCTCGATCTGGGCGACGCCCTCGCGACCGTGAACGCGATCGGTCCCGCGTCGAGTGGCTTGCATCGCGCGAGCGACTGTCTC
CACGGTGGCTGCCTTCGTCGCGGTTGTCCTTGTCGTCTGGTCTTCTGCCACTGCGGTCGTCAAAATCACGCGGGCCTCGTCCACCGCGACCTCCACGACC
GCCACCACGACCACCACGACCTCCTCGACCGCCCATATCATCGGGACCAGATCCGCCCATCCACGGTCCTGGAGGGCCTCGGCCAGCTCCACTACCACCC
CAGTGACCTGGCCCAGGAGGACCACCGTGCATTCCGCCTCCCCAGTTTTGCGACGGATGCATGTATGGCCCTGGTGCACCACCATGAGGTGGTGGTCCCA
TCCCAGGATGCCAGCCCCGTGGCGGCGGCATGAACCCGTGCTGCCCTGCCATTCCACTGGGCCCTGGAGGACCTCGCGCCATACCGCCCATTGGAGGCAT
GCCGCCTCCTGGTCCCCACTGGCCATTAGGTTGCTGGTTTGCGTCGCCCGTAGCTTGTTCGCCTTGTGGATTGTTGCTGCCGCCTGGACCCATTTGCATT
GGTGGTTGGCTGTTGCCGCCTGGAAAAGCTGCTCCCCTTGGCGGCATCCCACCTCCTAGAGGCGGTCCTTGCATGGACTTGATGTCGTGGGCAGGAGGCT
GCGAGGCAGCAGAGACTGCCTGACGCGCCGCTTGCTCCCGGGTCTTCTCCATGGCGAGATCACGACGCAGTCGAAGCTGGCGACCTGCATATTCCTGCAT
CAACGCATTCCGTTTAACAACAACACACACACAACGTTAGATTAAAGACTGACACGGTCGATAGGCTACTGAATAAAAGCTACTAACCCGCCAGGAATGC
TCGTCGAACCCATAGTTGAAATAGTCCGAAATGTCGACTCCAGGTTTCCGCCACGGCTTGTCTTCTAGCATATCAATGTCCACATCGAACGCCGTACGAC
GCCCGCCAAACATCGCCAGGTCATCGATGCCGTCTGCATCGCCCTACAAAAAGGCAAAACAGCACATTACCCCTCATAAAACGTAGTACAAAATGCTTTT
AACCGCATTCCAACTATGACGTACCTCGCCCTGCTTGTGGTGCAGATGCGATGCGCCAGCGGGAACATGCTGCGGCCCGCCAACAAAACTGCCGCGAACA
TAGCGATTTGCGCCACCTAATGCAGCAAAAGAAAGAGCAAACCATTTGGTTCGTTCTATTAGTAATTCTATCAAGATACGCTTGTAGTCCACAGTCGACA
ACAGTACCTCCTGTGAAGCGCAGTGTGGGTTTGCTGCCTTTCGAGTCGTTATTGAGCACGATCGCAATGTCTTCTTCGTCCTCATCCTCGTCAAAATCGT
CGTCATCATCGTTGCCTCCACCTGCTGTGCGCTATTCAAACGTCCCCATAACCTTCACTGTTCAGTACATACATAGAGCTTCTACCATAGCTACTATTGC
AGAAGCACGAACTCACCGCGGCTGGCCCACCACTGCTAGGAGGCACCATTTTGGCGTTCTTCTCCGGATCCGCGTTCAGCTTGATCGATACGCCGCCGTA
GAGCTCTTCGTCGTCGTCGTCGTTGTCGCCCGCACTCGTAGCGGCAGCAGTAGCGCTGCCCGAGTCCTTCCACGCTTCTGTCGTCGATGCCGCGGCCTCG
CGCGCCGTTTCCTTTGCCGTCACCAGCACATCTTCACCGAACTCTTCATCCTAAGCGTACATATAGAGAACAAATATTAGCGCCTATATACAGCGCACAT
ACACATGGAGAGCGCGCGCATAAGCATCACCTCCATTTTGGCTCGGGTCAGGGTGGTCGGATCGCTCTATGGGGGAAACCATTTCTGCGAGGATGTACTT
TATACAACTCACTAAGTACGAAAACCCACTCCCAAACCTGGGTCTCACGGGTTTGACCTTGGCCAATTAGACGGGTTCTTGCTGCTTGCGTAGGAAAAAG
TTTGGACCCGACCCATTTGGCGCTTTGGTTGCTGGAAGGGGACGGGAGGTCGTGATTGGCTCGCGGCCTCGTAACTTGGAGTTTGTATGCTGACGCCTTC
GCGGCCAATAGTTTTCGCTGTTGGCCGAGCTGCTCCGGTTCCGCGGCGCGCGCGGGGAAAACCAGTTCTTGTCTCGTTCAGATCTGCAGGTAAGCGGACG
CTCGGCGCCTCTCGTGGGCGGAATGGAGTGGGCGGTGGCTGGTGGCTCTGCGGATGCGGCGGGCGCTTTCTGGCGCTCGACGGGACGAGCAGAAGCAGCG
AGTGTGGCGAGTAGCATACGCTTCGAAATGGAAATGGCGCGGCGACAACGAAAAGTGGACGAGAGAGAGACAATGCATTGAGTATCAGTGTATCCCCACT
GGTTTCGAATGACGCAGACGATCAACTTAACGCACAAATAAATGCAGACAACTGGGATCTTTATGGGATTGCGATCTGCACGGCGACATACAGGAACACG
GAGATATGAACAGCAAACCGGGATCAACGTCACTCAGTGACGAGTCTGGAGCAAACCGACAGTACTCCACAGCAATCAGCGAGCAAACCGCAGTCGCCCT
CCCTCCTAAAACGCCACAAATGCGATCGCAAGATGATGACGGATAACAGACACTAACAGGTCGTGTGTGCTTCTGCAGGAGAAACTAATCAAAAATGCCG
CACTCTTTCGGTTACCGTGCGCGTACGCGCGACATGTTCGCTCGCCCATTCCGCCAAAGCGGTATGATCAAGCTCTCGACGTACATGCGTACGTTCAAGG
TCGGTGACTACGTGGACATCAAGGCCAACGGTGCTATCCACAAGGGTATGCCACACAAGTTCTACCACGGTCGCACTGGCCGTGTGTACAACATCACCAA
GCGCGCTGTCGGTGTCCGTGTGAACAAGATTGTGGGTAACCGCATCATCCACAAGCACATCAACGTGCGCATTGAGCACGTGCACCAGTCCAAGTGCCGT
CAAGGTTTCCTTACCCGTGTCAAGGAGAACGAATTGAAGAAGAAGGAAGCCGCTGCCACCGGCGGTATGTCTGCTTATGATTCCCTACTCAATGGTTCCG
TTCCTGATATCTAATCTATTGCTCATTGCCTGAATAGTCCGCGCTGTCATCAAGCGTCAGCCTACCCCACCAAAGGAGGCCTACACCTTGAAGACCAAGG
GTGCTCTCCCAATCACCATGGCTCCACAGCCTTTCGTCGACCTTATGTAA