Description :
From Genome Similarity Track
Location :
Scaffold_807:3749- 4928
Transcript NameFunction/comments
Phymu_g12025reverse transcriptase

Sequence
1179 bases(100 bases per row)
GCCACTGCCACTCGTCATGCTACTCCTCTTCGTGAGATTGCATTGCTTGGAAACGATTCTTCTTGCTtcgttcttgaagaaacTCGTACAGCAACGCCCC
ACAGTTGAgatccacttcgtccacccAGGTGGGATCCTCGTATCCTTTCCAGAACACTTGGAACTCCCGCCGGATCCGGCCATACCGCGTCGGCCTTCCA
GTCCTCACGTCAACGATTCGCTCGACTTCGAACTCACCGTCCTCAAGTTCACGATCCCAGCTGTTTTCGGGTAATAACGCCTCGTCAAAGTCCAGACGCT
TCGCCCCATCGACGGTTAGTCGGATCGCGGGCCGATCCGGGAAGATCTTGAccggcttcaacttggagagGTGTACCACAGGGAAGAGGTGATAATCCGT
TCCAGCGACCTCAAGGCGCACCGCATACTCGCTCACCGTCTCTGCTACTCGGAATGGGCCATGCCACATGTGGGCCAGCTTCCTCGCGTATCCTTCTTGA
CTCTGTCCAGGAAGAGCCACACTTGAGATCCGGTCTCGGTGGTGTGCACCGTCGCGGCTTCGTTGTTCCGGTCGGCGCGCTCCGTAATTGCATCCTTCAG
CCGGTCGTTGACTTCTGCGCGAGCTAACTGGTAGAAGTGTTGGATCCGGTATCTCCATCGACGTGGCTCCACATCTCGACGTCCAGTGTTCCCCAGAGAT
AATGTTGCCTCCAGCGTTGTCTTAGGATCCCACCCGTGAGCCAGGTAGAAAGGCGTATCGCCCCTGGTCCGATCATGCGCGGTGTTGAGTGCGAACGTAA
GGCGCTCGGCATACTCATCCCAATCTCGCTGGTCGGGATCCTGGACGTACATCTTGATGGCTAGCGTGATCGTCTGCACCATACGTTCCGCCGTGCCGTT
AGACTGTGGGCGGTAGGCCATGGTAGCTTTCTGTCTTTGGCCAAGGATTCGGTTGAAAGCGCGAAAGAAGTCCGACATAAATCCGGGCTTACGATCGTGG
CGGATCGCTTGGCTAGCACCGAAACGTCGGAACACACATGCCTCGTACGACTCCGCTACCGCTTGAGCCGTCCGGGAATCGTTAGCGCTCGCGATCACGT
ATCCACTGAAGAGGTCCACCCATACAAGAAGCTCAGTGTTCCCCTTCATCGACTTGGGCAGCGACGGGATATGGTTCAT