Description :
From Genome Similarity Track
Location :
Scaffold_37:37486- 39032
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_37-snap-gene-0.29Conserved gene of unknown function
Pytve_DAOMBR484maker-pve_contig_37-fgenesh-gene-0.17Conserved gene of unknown function

Sequence
1546 bases(100 bases per row)
GTGCTCGAGTCGTCACTGCTGAAGGACGATCTCGAGTAAGTGTGCTGGTAGTCGCATTTTCGTATTGGTATTGTGATGTGACTAACACTTGTGGCGGCTG
GACTGACTGCAGAGCTGTCACACTCGCGTTCCTCCCCCCTGAGCGACTTCCGAACTTGATAGATAATGTTTCTCGGCCAGCAAAAGCAAGGCGTGTCGGC
ACGAACACTACGCCTCATCAGTCCGCTCGGGGAAAGAACCACATTCCAGCGGTTGGCGTGACGCCGAAGCAACCACCAGTAGCTGTCGCGACCAAGACCG
ACGACAAGGTGGAGCCGCCGGTCACTCTGTCGACGACCATCACCCCTGGCGGAGTCAGCACGCGACCAACGCGGCTCAAGCGGTTACGCTGAATGGAAAT
GTGTGATGATTTACAGAAATGGTTAGTGGTCAAACACAGCTATGGTTCACACCGACACTGCGGCATGTTGTGCTCGAGCCACTCCACGACATCGCTGTGT
CCGGCGACAACAGCATCGCGGATCGCACGACTCGTGCAGCCTTCGCTGCGGTGCTCGTGCAGATATTCGAGAACATCCAAATGTCCGAACCAGGCCGCGC
CGTCCATCGCTTTGGTCGTGCAGCCTTCGCTGCGATGCGTCTGCAGCCACGCAACAACGTCGAGGTGTCCGCAGCGCGAGGCTTCGTCCATCGCATCGGT
CGTGCATCCTTCTTGCCGATTGGTATGCAGGAACTGCACGACATCGAGATGGCCAAAGCACGCCGAGTCGTTCATTGCGGCGACGGTGCAGCCCTCATCT
CGGTGCTCGTGCAAGAAGCGGACGACGTCGAGGAAACCGCCGGCCGCCGCGCGGTCCATCGCACTCACGGTGCATCCCTCCGATCGCTGAGAGTGCAGGA
ACTGGATGACAGCGAGGTGGCCGCCGGACGCAGCCAGGTTGATGGCCCACATGGTGCAGCCCTCGCGTCGATGCGTGTGCAAGAACTTGACGACGTCCAG
GTGACCTTGTGATGCCGCGTAGTCCATGGCCAGGATCGTGCAGCCCTCGGTCCGGCGCTTGTGCAGGAACTCGACAATGTCCAAGTGGCCGCCTCGCGCC
GCCCAGTCCATGGCGCTGGTGGTGCAGCCTTCGCTCCGGTTCTCGTGCAGAAACTGCACGATCTCCAGGTGACCTTCGCGAGCCGCACAGTTCATAGCAT
CCGTCGTGCAACCCTCCGTTCGGTTCGCGTGCAGCCACTGGACGATTGCGAGGTGGCCGTGCTCCGCCGCTCTGTCCATGGCGAGCGACGTGCAGCCCTC
TGTTCGATTGGCGTGCAGCCACTGCACGAGCTCGAGGCTGCCGCGCATGGCGGCGAAGTCCATGGCGTGCGACGAGCAGCCTTCGTCCCGATTGGCGTGC
AGCCAGTACACCATGTCGTAGTTGCCGTACCAAATGGCAAAGTTCATGGCGTACGTGGTGCACCCCTCGGTGCGATTCGCCGCGAGCCACTGGACGACCC
CCAAGTGTCCTCGTCCCGCCGCCTCGTTCATCGCCAGCGGCGAGCA