Description :
From Genome Similarity Track
Location :
Scaffold_2:374852- 381231
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G001043Similar to vps13D: Putative vacuolar protein sorting-associated protein 13D (Dictyostelium discoideum)
Pytul_DAOMBR144PYU1_G001042Similar to PIGB: GPI mannosyltransferase 3 (Bos taurus)

Sequence
6379 bases(100 bases per row)
TGCAATGAAAGACTTGCGCACTCGACGATCCCAACTTCCGCAGGAGCTGCGCTACTCGCATCACCCGGCGAGGACTGTGCAAGATGCAGGATGTGTATCT
TGCACCCTTGAGGAACCATCACGTTTACCACATATTCATCGTGGTAGTCGGATGGCGTTTTGGTATTTGTCATTGACGAATTGGTTTTCAGATAGCGCAT
ATTCTCGTGAAATTGCTCGAGATCATAGCCGTAGCTGGTCGACAGGATGAATCCGAGGTTGTATCTGTCGTAGCAACTTCCAAGCCAACGTAAGGCAATA
TCAACCGAAGGGAGAAACAACTTGACGGTCACTCGTTCCAATAGGACGCTCGTTTCAGTCGTTTGACCAACGAAATACAGGACCGATGAATCACCGTTCT
GCGCGCTTTCCGAAGCAGAGTCCGAGTAATACCGCTGAACTTGGTGCAGGATATTCACAGCTGGACTTGATAGCCTTGAATTGCCTTCAATGTCGAGAAA
CACATTCGAACCTTCACTGAGTGAGATCGAACCCATCGTTATCCTTTGACTGTCGGTCGTTGAGCAATGACGGTTCTCGTACTGAAAGTTCCGCATCGAC
AATGTGAACAGTCCTTTCTGATATTCACCACCGCGGCGTTCTTCAGCAACGCGTAGTCGGATCTCTGGAGCTGATATGGACCACATCGAGTGGCAGAGAG
CACGACTTTGAGTCTTCCCATGTCGCAAGTGTAGATCTTTATTGACGCCTTCAGGCGAACTATCGGGCATAAAGAAAGCCCACTTGCCGATAGCCCACGA
AATCGTCTCAAGTTCATCAACCGTCCAGTCAATACTGATAGCTGGCAGCACGATGTTGTAGTTGTACATTGCAGTCTCTCTTTCTTGACCCAGTGCTGCA
AGACCTCGTCCCTGACTCTGCTGGCCCGACCCAGTGTGAACACATGCGTAGGCTTCGACTGACCAATTTGTCCGCGAGTGGCTGGATTTGACGAGTGACG
TATCGCCACTGATCACCAGTATTTCGTGCAGCCCCTTGAACTGAGCCAGACTCTCTGCAGCTTGGATCAAATCCAGAGTCTGATCGATGGAGAATAGCCG
AGCTCTCGAGCTCTGAAAACCGCTAACAACAAGCTTTTGGTCGTCCGATACTCTGGTCGCTCCGCGTAGCTGCACCAACTCAGCACCAAAGCAGAAGCAT
TCACGCACGGAGAGCAAGACTTGAAGACTCTCCAGATCGATCGACATGTTCGATATGGGAGCGATGCGTGCCTCATTATGCGCCAGCAATTTGCTTGGGT
GTGATAAATTCCACTGCTTCCACCATAAATAAACCGGTGCAAAAAGCGTCATCCACAGCACTAAAGTCTCATCTTTGAGAGCTAGCACCGTCTTCTGCCG
GAGCTGAAGATCCATTACGGGCTGGTGCCCAACAAGTCGACTTTGGTATGCAGGAATAATGCCCTTGAAGAAGAGGAATGGACTCTTCTCTGCATCTGGG
GACGTGACAGAGCTGATGATTTCATACTGCTGCATCGTACCTCCCTTTTCGTACATTCTCAGCGATTCGACCATCAGTTGGAGCTCATCTTCCACACACG
ATTGCTTCATACTTGCCCATGCCTCACCGAGAACCCATGTCCACACTCGACGCTCAGCCTTCGCTGAATCGTCGACTTCACGAGAGAAGAACACGAAACT
CACACCTTGGTGCATTCCAGCACGAACATAGAGGCTTGGCGGCGTGATCGCATCCTCAAACTCATCGTCGTCGTCGTCATCTTCATCTCCTGCGAGAACG
TAAGTTTCCCCAGCAACTCCATCCAGGCAATCCGACAACAGCCATTGCTTTGCATACGCTAACACCATTAAGAACCCTTCTGGACGCGACGCCTGCTGCT
GCGTCAGCATAGCCAGTCGATCGTATTCCTCATACGGAGCCTTCACTTCAATCAAAATCGCGTACATAACGTCGATATGCTCGGCACCAAAATGTATCCG
CGGTTGCACGACAGCAAGACCATCGCTTTTCTCCAGCGGCGCACAGCTTGTACAGATGTCGCAACTGGCGCTAGCATGCGAGGGGCGGCTGCCAATGTCC
ACATCGAGCTCAACATCTGGGAACGACGCATTGGAGCTGTGATAATATAAACTCGCCTGCAAAACAGACACATGCATAGCAGCCACATGTGAGTGAGCAT
AGGCAATCTTCCTGCTATGAATCATAGAAAGAAAGTGATTGTGCTGTCGACACTTACTTTGATGGTGCTGTACCAATCGTGAAATAAATACTTTTTGCAT
ATCTGCGGAGCGTTGGCGGACGCAGTGCGATTCTCGTATTCAATGTACGCTGCCACACCCTCGATCGTCAAAAGCTACAAAGAGCTATGGTTAGTTTTGC
AGTCCATACATTTAGGAAAAATACTCCTTTTCATGGTGATTACGTACCTTTCGCGACTCCATACCAGCACTTGACTGCGGAGTAAACATGAGCTCCCAAT
TCGCGTTTGTATTGATGAGACTCACGAAGCCGATCTCCAGCGTGGCACTTCCTGGACGCTGCACCATATACCGCATTACATTCGAAAGCATAGACGCATT
AATAAGCGACGCCTAACACTAGTCCACAAACTAGGCCGATACACGCACTCGTACCTTTGCCAATGACGTCGAAGTGCAATCGTATCGCACTTGCACGTCC
GAGAGCTCGATTTGCACATTCGAGATGATATGCGCCACCAAGCGGGACAGATACGTTCGATCTATAAGAATCGGACACAAAGGCACATCAGCCCTCTGTC
GCCATACCGCATTCGCAATGCCTGCTGCTTGGGTTACAAGCAGCAGGAAGAAAAAAAGAGATACGTTACCGTCTGCAATGTCGCCGCTGTCCGCATTGTC
AATCGCCGTGTTGCCCACCAAACCATCGTCGTCCACCAGCCCCTGCAGCGTCAACGCCGTGGACTTGGGTGTCTGGTGCAGGAAAATGCGGATGTTTTGC
GCTTTAATCACGACTGCCTGCGTCCAGAGCGCGCGCCACGGGATTTTGACGCTCAGGTGGCCGATCGAGCCTCCTCCGTACGACAGCCGCAGCTGCAGGT
CCTGGAATGACAGATCGCCCTGCCACAGCGACAGCCGTAGCATGCTCGAGTCGAAGGACACGAACTTGCCCAGCAGCCGCTGCAGCAGCAGTGCCACCGC
GCGTTGAAGCATCGCGTCTCCGTTTCGTTTCTTCTCGTTGGCCAACGGCTAGCGAGTCGCTTCTTCCCCCCGTTCGCTCTGTCGGACCGCCGCCTGCGTG
CTTGAGTCGTCTCCCTCACCGTCGTGTGCTGCGCGTCTCCCCTTCGTCGCCTGCGTGCGGGTCTCTGTAGTTGCGAAGGTGGCGCGCTTTCCTTTCTTCT
TCTGCTGTTTGTTCCCCCCTCGCCCGTGCGTACAGAAAAATAAAGTGGATGTACCCCGCACGCAACGTCAAGAGTACTGAAATAAAAGAGATAGAAAAAG
GAAAGTTACGAAGTTGTATCATCTAGGTGTAAATATTAATTATATCAGGGTTGTGGGACTCAAAAAATAAGTAACTGGTGGTTCGTTTCTGCGTGTATGA
TTGCTGAGAGGATTAAGTTGGAGAGGGTTTTGGAAGTGTGTGTGTGCTTGCGTACCACTTTGACACTATTTTGGTTCGGATAGGGGAGAGTGGTCCATTT
GGCTTGCAACAGCAGCAGCAGTAGTATAGCAAAGTAAGAGGAAGCGAAAAGGAATCCAGCTTTCGTAGTCTCTTTGTCAAGCCAGCAGCACAGGGCACCA
GCATGCTGCCATTATTGCCCTACAGTCATCAAGTCTCAGCCAGTTTGATTGACATCTGCCTTTGAGTCTCCTTCTCTACATTCTTTGGATAAGAGAGAGA
GAGAGAGAGAGTTTCTGCTATACACCCCCTAACCATCCACATCCGGATAATTAGTTGGTAATGACCCCCCCTTATTGGCACTCCCTCTGGCAACGCTCTC
GTCATTCCTACTAAGATCAGCGTGTGGGAGCATGACGTGGACGTGGGAGGGCCTCGCGACAACGCGCGCGTTCTGGGCGCTTGTCGTGGGCTTTCGCGTG
TGGAACGCGCTCTTCGTGCGCACAGCCTTCAACCCGGACGAGTTCTGGCAGAGCACCGAGGTGGCGCATCGCATGGTGTTCGGCTACGGCCACCTGTACG
TATGTGTGTGCGCCACAGCATCGCATGGACTCTTTGCTGACGCGTGGCTCTATGTGAAACACTAGGACGTGGGAGTGGCAGAGTGACGCCAAGATCCGAG
GCTTTGCACACCCGGGGCTCTTTGTGCTTCTGTACAAGGCCCTGGCGCTGTTGGTATGAGAAACATCGCGTCTTTTTTTTGCTTTATTGATCATGATGAC
AAGTGCTGACAGCCTCTGCGTTTTCACTATAAAGAATCTGGACTCGCGATGGGCCGTTGCGTATGGACCGCGCATTCTGCAGGGGCTGCTGTCGGCGCTG
AACGACTACTTTCTCTACCGCCTCGCGTGCGTGTACTTTGACCGGCGCTCGGCCAAGTGGGCGCTGCTCTGCAACCTCTTCTCGTGGTTCATCTTCTACG
CCATGGTGCGGCCGTTCTCCAACTCGATCGAGACCGTGTGCACGACGGGCGCGCTCGCGTATTGGCCGTGGAAGTTCCTCGAGGGCGAGAGTAGTAAGAA
AGAGAACGTCGACCCCATGAAGAAGAGCAACCGCGTCTTGGCGCTCACGCTCGCAGCGCTCGGCGTGCTCTTCCGTCCCACGAACGCGATCATCTGGGTG
TACCCGGGACTACTGCACCTAATCCAAGCGCACGATCGCACCAACTTGGTCCTTTTCAACGTGCTCCCAATTGCAATCGCGACGCTCGCCGCGATGCTCG
TGATCGATCGTTGGGGATACGGAGAGTGGACGTTCGTACCTTACAACTTTGTCAAGTTCAACGTGCTTGAGGTACGATCTTCATAATGCGTCTTGAATGG
TATGTAAGCGACAGAGAACTTGATCAACTCAACTGCTTGTTTCTGCTGTTGGTGCTTGTGCAGGGCAAGGACAAGTTGTACGGCACCCAGCCTTGGAACT
GGTACGTCGCTCAGGGATTCCCAGCTATCATCGGATCGGCACTGCCGCTCGCCATGGCAGGATTCCTCACCGTTCCAGTAAGTATTGTAATTCGTGACGT
CTTCTCTGTTGAATTGGCTCTTAAAAGATCGTTGCGATACAGGGCCTCAAAAAAGATCTTGGACACATCATCATCTGGGCGCTTTTCTTGTACAGCAACG
CCGCCCACAAAGGTAAGAAGCCCTTACAGAAAGAAGCTCTCGTTTTCAACTGGGAGAGCTTGTGGACCGGATTGGGTCACTCACTGTCCAACATTGCAAC
ATCTCTTGCAGAATTCCGCTTTGTGCTGCCGCTGCTCCCTCCTGCGCTTGTCTACGCTGGGTACTGCATTCGCAACCTCGAGAACAAGCTCTACGTCCAG
TTTCGCGAACGAACGCAGAGCAACTTGCTTCGCCTCGCTGTCTTCACGGTGGTCGTGCCGAACATTGCCGCGGCCTACTATCTATCTCGCTGGCACCAGG
TAACGTTTGTCGTCCTTTCTCTATAGTACTCGCGACCTTCGCTTGCATGTGGCTAATCCGATTTGTCACGTGCTGTGCCTAGCGAGCGCCAGTCGAAGTG
ATGGACTTCCTCCACCAGCGCATTCAAGGTACACGCTGATTTCTTCATTTTGCTGACCGTGTCGGAACGCTTTTCTTATTCTGAACTGTGCCCCACATTG
TGGAATGCAGAAAACCCAAGCACATCGATTCACTTTTGGACGCCTTGCCACGCCACGCCGTACTACAGCTATCTGCACCAAAACGTGTCGATGTGGTTCC
CGGACTGCTCACCAGCGTACGTATCGCTTGCACCAGTCAGTTCTCCTTGACCCTCGACTTACAAACGCCGGAATGCTGGTGAAATTGTTATACAGAGGTC
GTGAACTGCCAGAGGGAAGCGAATCGCAGCGTCTCGAGCGCGATCCAGTCGCGTTCTTGAGCAGCAAGTACCACTTTTCCGCGTCTTCGTCCCAAGATGC
CACGCACGAGAAGCTCCCGGAATACGTCGTGATGTACTCTCCAACGGCGAAAACGATCGACGACCTGCTGGATCGCGCACATTACCTGGAGGTATGATGG
TTCTCATTCTGCGTATCCTTCTCTCGGCATTACGCTGATTGAAATCTTCTATTTTGTGACCCCACAGGAAGCGTCGTTTTTCCACAGCGATGTGAGTGGC
GACGCCGACAGCTCGGACGTGCTGGGGAAGATGCTGGTCTTCAGACGAGCGTAAGATGCTGTCGCGTTTGAAAAATGCG