Description :
From Genome Similarity Track
Location :
Scaffold_161:37484- 40111
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_161-fgenesh-gene-0.47 transmebrane protein Gpr8

Sequence
2627 bases(100 bases per row)
TCTCTCTCTTTATCTCTGCTTGCGGCTCCGCACCAACTCCAACCATGGGTCGAACGGCTATGTTACCGGCGCTGCTAGTCGGCGCTGCTATCTGCGCGCT
CGCAAGTCTGCCTGCGGCGCGCGGCAGCGTCGTGGCGGGCTTCCTCGTCGGCCGCCAGTTCGCCTTTCTCGGCAAGTTCTGCTTCTCGTGGAAGCCGACG
CTCCATGAAGTCGCCGGGGTGCGAGAGATGACGATTCATGCGGCTGCTTGTTTGCACCGTCGCCATCGAGTAGACACTAACGCTGCTGTCCTTGACTGCT
CCAGCGCATCGCCGGCGAGATTGAGACCAACGTGAACGACCTGCAGGTGGCCATCTACGACGATGAGGCGCTCTTCTGGAACTACATCATGACCGACCCG
AGCTGCGACTGCCGCTGCAAGACCTCGCGTAGACACACCAAGCACGTGTTCAACGTCACGGGAACCTCTGGCGCGCTCGACATCCCGTTCGACTTCTCCT
TCAACGTGCACCAGCACATCCGGCCGCGGTTCTGGTATGTGGCGCTCGCGCGCTGCGTGCCGGGCGGCGACGAGTACCATCCGGCCTTCACGCAGATCAC
CGAGGAGAGTTTCCGCAAGTACTACTTCTCGTCCTGGTACGAGCTCCACTTCACCCAAGCAGACGGTGGCGAGCTGCCGGTGCAGCAAGAGGGGTTGCCC
GTCGTCTACGGCGTCATGGCGGCGCTCAGTGCCGTGACGGCCGCTGCTCAGGCCGTGTCGGCGCGCGCCATGCGGCAGTCCGAGTCATTCCACCCGATCG
TCAAGCTGCTGACGCTCGTCGTGGGTTTCTTCTTCGCGACCAACGCGCTGCTGTGTCTGCACTTCGTCGCCTTCGAGTTCAACGGCATCGGCGTGCCGTT
CTTCAACTACTCGGCCAAGATCATGCAGGTCTTCGTGCGAGTCGGCACCATTTTGCTGGCCATGCTGGTCGCCAAAGGCTGGACCATCACGAGCGTCACG
CTGCATGGGCAAGAGACGCTGTCGTGCCTCATGATCACGATTTTGGGACTTTACCTGTCGATGGCCATGTGGTACCTTGTGTGGCTTGACCCGGCCTCAA
CACTGTACATCTACGAGTCTTGGCCGGGTGTTGGCATCTGCGCTATTCAACTCGCGGTGCTAGCCTGGTTCGGCAACACGCTCTTCGAGACGCGGTCGTA
CGAAGAAGCAAAGAGCAAGCGCCGATTCTTCCTCCAGGTAAGGGGATAACAATCGAAGTCAAAAGGCAGGGACTAACTGATGCGACGGGGATAGATCGGC
GGGCTGTTTGCGCTCTACATGATCGCGCTGCCGATAACCGTGCTTATTGCCTCCTTCCTGTCGCCGTGGGTGCGAGAGAAGACTGTCGCGGCGATATCGA
CCTCGGTCGACGTTTGCGTCTACGCGGCGCTCGTGTACATCCTGTGGCCGTCACGCGCACCACATTTCTTCGAGGTACGCTCGCTTCAGCTCTCCTGCGC
GCGATTGTCTGTTGAACAGTTTGTGGTGACGGGACTGTCCCTCGTTAGCGCCTCTATTCTGTCTCCACTTCGGGCGAGAAAACGTTGCTGCGCGAGCAAA
ACCTCCCAACCGAAGAGCTTTAACCCGAGCGCTCACGCTGACTACAAGCTGATTTTGTCGAACGTGCGCCGGGTCTTCCAGTATATGTCGAGCAGCTGCA
GTTCGATATGCGAGAGCTGCGCAAACGCGTGCACCACGTCATCAGTGCACGCATCGGAAGCTTCGGGGTCTTGGAAGCTAGTTTCCGCTTTTTCTATGAG
CTCCTACAATGCGTAACGATCACATCAATCAACCATCATCGTGCATTGCGTACCCAAAGAACAATCGTACCTTGACTAACACCTCGAGGTGAGCAACAGC
TGCGAGATGAGTCCCTAGCCCGACTGACAAGCGAGAACAGAGTTCCGGCGCTGTTTGTGGGCCGTGGTTGCGTTCCTTCTCCAGATCAGCGAGTGAGTGA
AGTACCAGAGCTCGCATCTATTCAGCCACAATCGTGAGCGCACATAGGTTAGACAATAGTAAACATAAATCACACACTCTGACGGCAAGAACATACCGTT
GAGAGTTCTCGGGGATCCGAGCACTGCATGGCAATCGTGAGCGCACCGGATAGTTGTGGCTTGGCCTCCAATTTCAAAGTCAGCAGGTTATCGGCAAGAG
TTCGAACACTGATCCACATCCGGCCACCCTTCATCACTCGCCGTTGCTCCTGCAAGATCGCAGCATCCATCTCAGGAAACAATCGCTCTAGAAACTCAAC
TAGCACCTTGGCTTGAGCCTCCTCATCTTCCAGTGCCGCGTCCCGAAACACGGAAGGCACCGTCACTGAGAACCGAGCAGGCGGAGCCACAGTCTCGACC
ACGCCAGCCCCCTGTGCCGCTCTTGCACTCAGCATCTTGAACCAGAGTTGCCGAAACGGTCCGTCGTTTTCAGCATGCGCAGCAACGGTGGACCACCACG
GTACACCACTTGAAACACCTGACAACCTGTCGACTTGACCATCGTTTCTCGAAGTAGCCGAGTCTTGTTCGGCGAGTTGCAAAAGCACCACCCGAACCGG
CGAACACAGCGGGATCGATACCGCAAA