Description :
From Genome Similarity Track
Location :
Scaffold_816:3748- 8741
Transcript NameFunction/comments
Phymu_g12060hypothetical protein
Phymu_g12061hypothetical protein PHYSODRAFT_312106

Sequence
4993 bases(100 bases per row)
GTCGGTATTTGGAGTGAAATGGGAACGCAACCACGTTGTAGCTCTCGATCTGTCGGAAAACGGACTCACGGGGGAATTTCCAGTCGATATAGTCCGCCTA
CGCTTCCTCACGACGCTCAAGATGCGAAACAACCAGCATTTACGAGGCCAACTGCCTCGAGAAATCTACTCGATGCCCCACCTCAAATATTTCTATGTGG
ACGGCACGAAGATTGAAAAAGCACTTCCGTTCAACATCGCTCACTCGTTCCAAATTTCTCAGTTGAAACTTCAATCGGGTAGATCTACGAGGTCTACGAA
ATCTACCGTGAGTTTTTGTACGGGCGACGAGCGTTCTGGCAACATCATCCACTGGATGGCCGACATGACTGAAACGGAAATGGAAATGGTGCGTTCAACA
CTCAAGAAATTGCACGACGACGCTAGTGGTCATAAAGGGTGTGAGCAAATCAAGTGCACAGCCAGTAACGCCACTGGAcctgaacgagctgcagcggccg
tCAAGTTACAGCGTATATACCGAGCTCGTGTCGAGCGGACAAAATTCCGAAACTTTCTCCGTTCTCTTGTAGAGATGAAAGTTGATCCTGCCACTGGATC
CAATTACTACGTCAATACTCGAACGGGAGAAGCAACTTGGGAAAAGCCCAAGTTTCTTGCTTCCGATACGCAATCAAACATAAATGTCGAGAGTGATAGC
GCGAGTACCAACGTGTTAGACGAACGAGACGCCTGGACATCGTACGATGACGGCTGCGGCAACACGGTACGTGGATACTAGTATTAGCTTACAGAAATAC
TGGAATACTTAGAAGTATTCACTAATATTTTGCCAAATGCAGTATTACTGGAATAGTATGACAGGAGAATCGACCTGGGAGCCTCCAAGTTTCCTTAGCC
GCATCTACGAAGAGCTCCGAGAACGCTACGGAAGTGACAAAACGGATGAAGAGCGGTTCGATCTCTTTTTCCAGGATATCGATCGTGACGGTACTGGCGA
AATCGACCAGGACGAATTTGCTCGGCTGTGCGGCGACTTAGGCATGGCTTTGTCTGCCAAACAGATACAAGAGGTCTTTCGAGAGCTCGACACTAGCGGC
GATGGCCAACTTGATCGTCCGGAAATCGTCGCGTGGCTGACGCGAAACTTTAAATGAAGACTTCAAAGTACAAAATCTTAACTGAATTCAATACTCAATA
ACAGTTTTCTCTCTATTCATCATCAcagaggagctgcagcaacttctcggagTCGGCGATCGTACGCGTCAAGCCAATGATCTGGTTGCAGCTGATCAAG
TACGTGTCAGTACAAGCACACTTGACTGCTGGAGGCTCCGAGTCATCCAAGTCTGCGATCGTTTCCGATCTGCGGAAAGTGGCATCGAACTCCACAATCA
CCGAGTAACCAATGGCTTGGAtgctcttctcttcgacGGAGAGTACATCCAGACACTGCTTAAATAATGACGCGTATTTGATGATACCTTGGTCACCATG
GTAAGTCCCCCAAAACGGCATCTCCTCAGGAACTTCGGACTtaaggaagaagctggcagAGGTCATGGGCCCTAACAGGTTGATGTCTGGGATCACCAGG
TACGGCCCACCGCGGTTCTTAGCCACACACTCCACTAGAATCGTGTTGGCTGCTTCGTCGATatcgctgaagctgttccgTGACGTCCGTGTCCTGCTAA
CAGCGCACTGCATGGCCTCAAACCATCGCATTCTTGTTACGTCCGAGCGTGTCACGAACGTCAAcgtttcgtcttcttcgcggtGTCCGTCGAACACTTC
AATCTGGAAGCCAAACGCGCCTCGATCTGGTCTTTTCAAGCTCCGACCGAATGCGATCCACTTTCGCGCGTTGCAGACGACCAACTTCTTCGGTCGAGAC
GTCCACGTCTGCTTCTGGGCCATAAAGAATTGTTTCAGCATCGATGCTTTCGACGGAGAAGTGGCTTTAGAAACTCCGTTGCTCGGCGAGCCTGATTGGA
CGTCTGCGGCGTCTTGCAAAGTCAGCTGACACGTCGATTTCTCAAACTTAAGGTGCACCTTTGCCCACTTCGAGCGCTTCTGGTAGGCATAGCCACTTAC
AAAGAAATCATCTTCCGCTACATCGAACGATGTGGACGCGTCTGACTGCAGAATGTCAAGAATGGACTTCGGGAACTTGCTCTGGGATCGACTCTGAAAC
ATATCGCTGGGGTGGACTGCTTCCTTGCCTCTTGCCAGATTATGTGACGAACCAAAGCCTTCCTTCTCCATGGGCAAGCGTCGAAACGGCTCCAGCTCTC
GTGACAGGTATTCacttgctgaagacgacggccGCGCAAGCAAGAAGCCTGTgtcagcatcgtcttcactCGTATTCCGCTTTCTGGGGGTCCCATGGCG
AGTGCTAACAGCGACAACTTGCAATCCAAGAAGTGAATCATCAAGTGCATCCATCTGCTGATAATGTTTGGCCACTAGGGAAGCCGCGAAGTCGTTCCAG
CCCTTCACGTTGTTACAGAACTGGCGAATTaattcctgctgcagtgtgGGCGAGCTGCAAATCTTGGCAATTTTTACGCCAATGATGGCCAAGTGAGCGT
CGTAAATGTGCGTTGAACTGTTCGAGCCCAGTTTGCGCAGAATGAACTCCAGAATCGAGTCGGGTGAGCGGAAAACACTTCGCAGGAGCGGGTTGTTCAC
GCGCCCGTTTGAAGACGGTCGATTCAGCAGGTTCAAATAGAGCTTTACTAGGCGGCAGTGCAGTATACTTGCCTTCGGGAACTTCTCAAACACGTCCATC
AACGACGTCGCGAGATCCAGTCGGGTCAAACGGCTATCGATACGATCCTTCGACATTAAAATGAcggcatccagcagctccacaacGTGCATGACAAGCA
GAGTTGATGCTAATGGCCGGTGGTTCACCACAGTTTTCCCGGACCTGGGCGAATAGCTGAGAGCAGGATGAGTTATCCCCATGTAAAGCGTGCTTCGTGC
AGGCGATGCGTCACGTTTCGTGTGCTTACTGGGGCTTCCTTTCCGTGCAAGGGGCTCGAAACCCTCTCCGTTCTCTgtgctgtcgtcgtctgaGTCGCTG
TCACTAAAGCAATCACGTGCAGCAAATTCCGATATTGTAGATAAATGTTGGTGATAGTTGATAGACGCACAAATTGTATCCAAAACGAGATGGATCGGGG
CGACAAACGCTTCCAACTGCTCTGAATCATGTTGAGAGAACTCAATAGCATGCCGCAAGATATCAACCACGAGAATGCGAGGGATACAAGCCCCGTTCAT
GTGGTGCGCGTCCAAAAATCGAAGTTCAGCCATTCCGAGCTCGGTCAATCGATCAAGGATGGTTGAATTCTCTGTCAGAGCAGCCAAAACTGCGCACTTG
AGCTTATGGTGCATTGCAGGGTCGCTTGGAGCCATTCTCGGAGGAAACAGCTCCTTTTCAAAGGATTCGACGCTCTCAAACGAGGCCAGTTGAATTTTTG
TCTGGATGTAGTACCGGAACGTGTTGGGAAATTCGTCCTTCAAGATCTTCGTCAAGATTTCAGCACAACCACTTATCCTGGCATGAACTGTAGATTCTGT
GTTTGAGGTAAACAATGACGGAGAGAGTGGCGCCGTCTTGGAGGAAAAGAACGAGGATGGCGACACGGTTGGTGATCCGCCCAGTGACGACCGCGGCGAC
GTAGACGACGTTGATGACActgttgacgttgaagacacAGACGAGAGAGACCTGGCCAGTCGAGTAGGCACTTGCTCCACAATCTGTCCCACCAGGCAGC
GAATGATCGGAAAGTAGTCGAAACCTCTGCGGATAGAAAGGTGAATCAAGCCATGCAGCAAACCGCCAACGTCGGGATTGTACGCATGCGCTGCAAGACG
CGAGAGCAGCCATTCCTTCTCCTCATCTTCGTTCTCGTCACAGATCAATCTGTGCACCGCTGGGAATGTCACGAAATTCTTGGTGATTCGGCACATGTTA
GAGGCTAAAACTCCGTCAACTTCCACTTCATCATCCAAAGTATCTCCGTTCTCCACTCCATCACTCTTCTTCGACCCTAAAAAGCGGAACAAGCCGCTAA
AGATGCGTTTCCACTCGTTCGCTGTCAGATCCTCGAGTCGCAACAAGTATCCGCGCGTGGCTgggtcttccagcagctcttcatcttcctcacCGTCCAC
ACTAAAGTCGGAAATGCTGCTTCCAGAACTCTCAAACCGCATACTCGCCCTCAGCCGCTGAATCCGCGCCATTTTTCTGGTCGACGCGTTGCTCCTAAAG
TCCATCATCGTCGGTAGGTTGGTTGGTAAAGCAGTCGTCGACGATACGGCCAGTCCTTCTAACTTCACTTCTGGCTGTCGGACGGTCTCCTCCGCTTTAA
TTCCAGCGTCCACCTGCTCGTTTCCATCCTGTTTAGGCTCTCCGTACCAGGCCATGGCCTTGAGGTAAAATCTAAGGATAATCTCCGTGGCCACGTACGC
CTGTCGGTATTTATCCGGGTGCTGTTCTTCTGTTCCATCCTCATCAACCTGACTGTGCAGCTCACTGAAGGCCGTGGCGTAGCTGAAGACCTGTTTAATG
GACTCTGGCTCAAGTAGGAGCTTCTGAACAGGAGAAAAGTGGCCCCTCTCTCTCCTTTGCACTGTGGTGAGCACTGTGTCAACGTCGTAGCAGCCACAGA
AGACGTTGTCCAGCGCTGGAGCCTGTCGAAGAGCCTCCGCATTGTGCAGCGCCTGGGAAGCCTTCAACGGGTCGTGTGTGGTCCTGgacagttccagcag
cgacagagACTTGGCCCAAGTCGTCGGAGGCAGAAATGGCACAGgaccacttccacttgaggcCTCGGAAGCCTCAAAAGCGGCCGGAGACGACGCCGTG
CGGGCGGTTTCGGACAGAAGGAGGCTGCCTcgctcgctctcgctctcgttgtcCGAGTCGGACTCAGTCTCGGCCGCGCACGTGCATTGgcgc