Description :
From Genome Similarity Track
Location :
scaffold_236:37470- 39419
Sequence
1949 bases(100 bases per row)
TAGATAGTTGACTATAAGTATATTCAGTCGTAAATCTCCCTATTCCAGGTATTAAGTCCCCTAAGAACAGGGACTAGTGAACGATTAATCACTTGGAGTT
TGCATACTCCTAATAGCACGCTTCCTCAAGACAAGTGCTCATGTGACCCTGTTACACTTGGTAGCACTTGTAGTCAATCTACCCGCGCAGGCGTAGATTG
ACTACTTGAATCCTCTGTGACCATCAACGACGGAGTGACCAAGATAGACTGACGTGAGTTCCCTCATCTGAACGACACTCAGTTTAAGTCGGTCCGAAAG
ATGACGGGCATCTTTGGAGGTGAAGTCCTCCGGACCTTACACCGACCAAGCAGGGCAAACGCATAGAGGCATTCGACACTTATGATACGAGGTCTAATCG
CTCATGTGCGGGGTTTCGGATCTCCACGGCCGAACAAAGGACAGCACATCCTAAGCCACTAAGGCTCAAAGATCGTCCCTACGAAAGGAAGGAGGGAGAG
AACCTCCACTTCTGGATTAGAGAAGTAGAGTTCGCGATGGACGCGGCTTTCATATAAACCGAGTAACCGCGTGTTACTTTTGCACTACCCAATCTTAGCG
GTCATGCTAAGGCTGGGGCGTACACGCGCGAAGTGACGACGCCGAGTTGCTTTGCAACATGACCTCAGCTGTGCAAACAGTTTCGAGCCGCATTCCCGCC
GGCAAACTATGAATATCGCCAGCGTTCACGCTCCCTCGCCTGTAAACAAGGGAAGCGTGAACTGCATGAGTATGCGGGTGCTTGCTGCATCTATGGTAGG
GAAACCCTACCTAAACACATCAAGGTGGCAGTGTTCATGGATGGCTTAAGAGTAAGCCCTGCCTGCACGCAGTTGTTCCACGTGCAGGCTAGCACAATGG
AAAAGGCGATTCAAATCGCCCTCCAGGAGGAATACAGCCACCAACGCGCTCGTACTCCTCCTTCTAAGTGGCAAAACCACAGTGCAGCGACGAGTGCGTC
CCATGAGACTCCCAGAAATGGAGCTAGTACAGTGTCAGTACTCCTGGGACTGGGTACAGCCGAACAGAGCTCCATCTGCTGCTACAGATGTAATATGATC
GGGCACATTCTACGTGCTTGCCCTGCAGGAGGACAAAGGAAATTCGTTTCCAGACCCAAGGGTTCGAGGGGTCACTGGCAAAAGCCACGACCCAAGAGCC
AGGAGAATGTGGCTCACCAGTAGTGGCGGGGCGCCTTACTGGAGAAAATGTAAGACTTCGGGGGGGGGGCGTGCTGACAGCGCACATCTCGGTGGTGTAG
ACCCAGAGAGCCTTGGTGCTCTCGAATCAAGAAAGAGCAGCGGCGGGCTGGTGGTGATACACACGAATGTACGGGGATACGATCACCTCTTTCGAATCCT
GATCGATTCATGCGCGTCGAAGAGCTTTGCACGTCGACAATCGGTCGTTCGGAATAGCAACAAGTCGCTGACGCTCTGCGTGGGAGCGAAGGCAAAAGCC
AGGTCTCGGTAAGACTGGTCGACGGTACGGTGATAAAAGTACCTTGGGTCCACATGGACCTAGCTGTAAAGTCTGAAGACTTTGACAGCACGGAACAATT
CCTTGTCCTCGAAATGGACAAGTACGATTTGATCCTGGGTATGCCGCGACTAGAAAAGGTGCACTGGATAGACTGGTGCGGTATAGCCATTGGGGCTAGC
CGGCCCGCAGTTTCCGACAGAGCATTGGTGAGTCATGTTCCCACCTCTGTCAGGAATCGGGGCGCCTACAGTGGCCGCCAGGACGCATCTGCGTCTAAAG
AAGAAATGAGAGCCGTGGACCCCGTCGAAGAAGTTGCAGTGGGCACTACAACGGGTCATATGACCAAGGCCCACTACCGAGTGTGTGGGACTACAACACT
AGTAGCTCCCAATGGCGCACCGTACGAGATTCGACAGTGGCAGTACCGG