Description :
From Genome Similarity Track
Location :
Scaffold_28:37457- 43804
Transcript NameFunction/comments
Phypl_g1147hypothetical protein PHYSODRAFT_508417
Phypl_g1148hypothetical protein PHYSODRAFT_504907
Phypl_g1149hypothetical protein PHYSODRAFT_505690
Phypl_g1150cyclin-H, putative
Phypl_g1151hypothetical protein

Sequence
6347 bases(100 bases per row)
AGCGTAACGTGACTCGCGTCTGCCGCTCCAGACCATtggacgccgtcgcagcGCTTTGGGACGCGGCAGCTTTCAACGATCTCCGTCGCTAGCCACTCGC
GGGCGTGGGTCAGCTTAGTACTCGCAGCGAGTGCGTGTGGCATGGCAGTCCTTCTGGGGACCATTTGCCGGCAAATTGCCGCGCAAGAGCTCACACCTGC
AGAAGATTGCTCACTCATACTATCCCAACGGCCGTTACGGCTTCAGGGTCCGCGTCATCGCTTATTAGCCAATCAGATCGTACAATGGAGACGTAGCGGC
GCGAAAATGTATCCATCCCCTCTGCCCTTCCAGAAGAGAGGAGCTCTTCGCCcaaagagagagagagagcgagaACATGGCACCGCTCGCTTGCACCTCA
CTACAAGATTTCCTCCAGCGGTCTCACGTCCAGCACAATGGCGATCACCGACAAGTGCGAGCTCCCTCTACTGCAAACCCGTACCAGCACGCTCCTCAAC
GCTTCGCAGCagacttcaacgtcgtcgtcgtcgctgctgcggtcaACTTGGGAGGGCATCCGCACCGaccgcttcaagctgcgctCCATCGGCTCCGTGC
TCGGATGGATCGCATTGGGCAGCTTCGTCAGCTCGGCGGTGCTCGCACCCAAGCAGCTGGTCGACTACACGCACGACGGGGTCTCGATGCACGCGGTGCA
AGACCAGCTCGACTTGATGGCGGCGTGTGCGTCCACCGGCAGTGCAAACGGCGAGGGTGACGTAGCAGACGTTCAAACCAACAAGGGCGCCGGCTGGTtc
cttggcggcgacgatcCCGAGCACGtcaagacgtcgctgccggaaGTCACGTCGTTTGACGAGCTCCCTGAAAACTGGGACTGGCGCGACTACAACGGAA
CGGGCATCAGCTTGACCACCAGCGTCATGAACCAAATGGTCCCACGCGCATGCGGGTCCTGCTGGGCGTTCGCCACCGTGAGCTCCTTGTCAGACCGAAT
CCGCATTGCGCGGTTCAAGAAGACTGGTCGCCTGGACACGGAGATGCTGCTATCTCCGCAAGTTTTACTCGACTGTGGAATGCGCTCGTTCGGTTCGTGC
CACGGCGGAGACCCGCGATACGCGCACAAGTGGATCCATGAAAACGGCATCGTCGACTTGACGTGCAACCCGTACATCGCGTCGCATCCGTCGTGGATGG
GAGGAGGGGAGTGCGCTGCGACGCAATGCCACACGTGCAACCTCAAGGGCGAGTGCTTTGTGCTGGAGGACCCGGTAAAGTATCGGATCTCAGAGTACGG
CACGCTCAACTTCACGACGCCCGAGGagttccagctgcaggcgatGAACGAGATCTACCACCGCGGCCCCATCGTCGTGAGCATGTACTCACTCTCACCA
GAGTACCGCCAATTCAAGGGAGGCTACATCCTCCGCGACTCAACCAAGTACCCCGGTACAACCCACGTGGTGAGTCTCGTAGGCTGGGGCACCGACGCCA
AGACGGGCGTCAAGTACTGGATCGTCCGCAACTCGGACGGCACCAACTGGGGCGACcacggcttcttcctcgctgAGAGAGGTGTCAACATTTACAACAT
GGAGAGCCACGGCGCCTGGGCCGTCCCCATCGTGTAGAAACCCATCTTGACCAGTAAACCCTAGAGTAGTAGTAGAGGCCCTTGACTCCAGAGTCTGGAG
CATGTTGAAGCCATCTGACCAATCGTAACAGGAGGACTATTTCATCCGTTTGATACCATCCTTTTCGGACTATTTCCCTCTCCGCCCCAGATTTTGGTCA
TCAATCTATCGGCGATGTcgcaactgctgctccggTCGTGGCGCTCCTCGCGCGCCGGCACCACGTTCCGCGCTCTGAGCGTGTTGAGTGGCATCTCGGA
AGATCTCCTtgtcagcaccagcatcggCCACCAGATTGGGGGCGACTCGCACGCTGCGTTGGTGGACAGTTTGGTCCGGACGAATGTGGTGGATGCCGGC
TCGCgactggaggcggcgctgagGCGTGTGGACCGCGGGGACTTCGTGGCGCCGGCGTTCCGGGACACGAGCAAGCGATACGCCAACCGCCCCTTGAAGA
TCGGCACGGTGGCTACGATCTCCactccgcagcagcacgcgcaggtgctgggGCTACTGGAGCCACACCTGCAGCCGGGAATGACGGCGGTGGACGTAGG
CTGCGGCTCGGGCATCCTCGTAGCTGCGATGGCTCACTTGGTAGGGCCGACGGGCTATGTCACGGGTGTTGACATTGTGCCGGAGTTGGTAGAGTTCTCG
AAAGAAAATTTGCAGCGCAGTTTGGGCAAGGGGGCATCGGACAAGCAGACGGAGATCATCGTCAGTGCTGGGAAGAAGGACCTTGGTCTGCCGTCTGACG
GTCTGTATGATTGCATTCATGTTGGCGTCGCGGTGGAAACCAAGGCGGAAGCGGAAAGCTTCTTGGAGTATCTCAAGCCTGGTGGTGGGCTGTTGATCCC
GCTTGGCGGTGCGGGAGctgagcagaagctggtcaAGGTAAGTCGTGTATGCGTAGCACAGACGACGAACCTCTTGCAGTGAGTTGAcgtttttttcttt
tcttcgATGCGTAGATGACGAAGCTTGCCGACGGAACGGTGGACAAGCGCGACGTCATGAGCGTTCTTTGCCAGCCAATGCTAGACAGCATCCCGATCGA
AGTAGTCCGGGAGACTCGCGCTGAGAAGCTGGCCCGGGTGGAGAAGGCTCTCACGCAGTGGCGTGAGGATTTTGAGGCCAAGAACGGACGGAAGCCCACG
CGAGACGACCTCATGAGCAATGCTGAGTCGAAAAAACTCTTTCAAGAGTTTGCTGCACTGAGAAAGTAGACGAAAAATAAGTGAGCTCAAGTTGTCAGTT
TCAGTTATGAGCTGGAGTACGATTCTCATTTTCTTCACATGAGGATGGGGTTGGTGTTGTCGTATCACGCATGCGCCGCTGCCTTGGTTttctgcaggag
ctgctccgCGAGTTGGATCTGGTGGGTAATATGCTCACGCTGCGTCATTTTCGCGTAGCGGGGCGGGTTCTCCGGTGTCACAAACAGTGGAAGTGGTTCT
ACAACGGTGTTGCCATTAGCGCCGTTAAAGCGCACGATCGACTGACGCTTTTTTTTTGAGTTGCACACGCGGTGCTGCAACACACAAGCACGACAAGCAA
CCAAGCTAGAAAAAGAAAGTTACCCTTAAAAATACTGCAAAGCCGAGTACATTACCTCAGTCGCGACTAGCACGCCATTAGTCCAGTGCTCGAGCATGTC
GCCAACCATGACAAAGAGCCTGTGGTAGGAAAAGTAAAGCTGGTCATGGTGTACGAGTGATCTCCAAATATACGACAACCTGCCGTACCTGTCATCACAC
ACCGGAGCTTCAACCCAGACACCCTGGCGGTTCATCAAGTGCAAACCTTCGCCGTTCTGATGGATGACAGTGAAGCATTCGAAATCCGTGTGCGAGGCAA
TCCCAACCGTAGAATTCTTCACGAGGGCATCCGTCTCAGGGTACGTTAGCAGTCGCATGAATGCCTCCGCTTCTtcgtccacgtgctgctACAAATCCCC
AAACAGCAACCAAGTCAGTACAACGTTTGCCAAATTCGAAAATATGGCACTGCGTACCAGGAACGTGTCGGCCGGAAGTCCGAGCATTTCCGCAAAGCTC
TGGAACAGTATCATTGAAAGCTTGGTGGTCTCCTCGTACAGTGCGTACACGTCCTCGCGAAAGTGCGGCACTTCGGCTGGCCAGACATTCGGACCCAAAC
TCGAGCCCTCCTTCACGAACGTCTCCGGGAGCTCCCGCGCGAGGTCGAAGCCCTCCAAGTGCGAAACCACATCCGGTTGGTACTGTACCATCCACCACAA
CACTACAATGAATAAAACTCAAACCACACCAGCATATTCTCCACGAATCCCAACGTACCGACGGCTCCTCGAACATGGGCGTCCAGCCTCGAGCATTGGG
CGAGCGCTTGCAATGGTACTTTTGCTTGACCGCGTCAGGCAGCGCGATGAACTCGTCTGCTCGACGGTACGCtgcctggagcagctggcTAGACAGCACT
CCCTCAGCGGGGACAGTGAAGAATCCCGTCTCGATGCAGGCAGCGCGCATggcgtccaggatctgggTCCTGGTCTCGGGCGCCACCTCACGACCGCTGT
TCGCAGCCGCCACCAACGGGGAGACatccacgagcggcagctgctgcagcgccaccttggaCGCCGTCATCACGcgcggcgacgagaagctccgagcgcc
cagcgccgcgcgagACGAAGAACGGAGGCGTGCGGTCCACATGGGGAGTGCCAAAGTGAGCCGCATAGCTTCAACATGGTGTGATGTACACCGAACCCTT
CATTAGATCATATATAGCCTACCTAATTTCATACAGTCCGAAGCCTACAGCTCACTGCTCTCGATCCGACATGTCGTAcctggcgacggcgacgcaTTTC
AACAACTGGGTCTTCtcggcggaggagctggcgcgtgtgcggcggctgcagcatgtGAAGGCCAAGCGTGCGTTGCGTCTGGAGCGAGAGGAGGCCCAGA
AGCCCGAAGcgacggccgccagcagccgcaaAGCGCGGTCTTTCGCCGCCTTGGTGCCGCGCTCGTCGACTGCCGTGCGCGACGCCTTCGACTGgaacga
cgaggtggacgtggagcttTCACCGCTagaggaggtggaggagaaggcaAATCTGCAActgacgccgctgctggagttcctGAGcccggagcaggaggcg
ctgcttCGAGCTTTCTACGAGGAGAAGATCCAggagagctgcagcgctcaGTTCCTGCGCACGTCGGACAAGGTCAAGTGCTGCGCCATGCTGCTATTCA
AGAGGTTCTATCTGAGCAACAGCGTGATGGAGTTCCACCCCAAGTACCTCGTCCCGACGGCCATCTACGTGGCTGGcaaggtcgaggagcagTACATGTC
CGTGGACACCGTCGCCGACCAGCTCCATGTGGACCACAAGTTCATCATTGGCCACGAAATGATCTTGCTGGAGGGCGTGCGCTTCCAGTTAATCATGTAC
CACCCGTTCCGTACGCTGCTGGGCTTTCTGGACGACTTCCGTGCGTTCGCTAAGCAGGTGCTGAGCAAGGACCTACCGGCGACGGTGCTGCAAAAGTTGC
ACGCCAACTCGACTGCTCTACTCAACGATATGCTGCTCACAGACCTGCCCATGTTGCACTACCCCTCGTATCTAGCGCTTGCAGCGCTGTGGCATGTGGC
GGACGAGGTTGCTGCCAGCAGCGGTGAAAAGGCTTGTGGGCTCGCGAGCGCCGATGTCCTGGACTACATCAAACGCAGTAAGTTCTCCAAGGATCAACCC
GTGGATGAGGTATCTGGTCGGCTGGAGCAGATTACACAGGCGTTCCAAGCGCTCAAAACAgacaaggagaagggcggcgaggaggcggcgcacCATCGCG
CCAAACAGGTCAAGCGTATCTACAAGAAGCTTAAGCAGTTCCACAAGGATGACGAGAACAGGaaagacaagaagaaggacaagaagcgcaaggccaagga
cgaTAAGAAGAAGGTTaagaagcagaagaaagACAATGCCTAAACGCGTAGAGTCTCCCGCTAATGAACCGCCCTAAGTGTTAAAGTTCACCTTCCAATG
TCCCCGAACGCCTGATAAAGACGGCAGACCGGAAGATTGCGGCGTTATGATATTATCATAGTATATAGGATTGCACTTGGCAAAAGTGGCTATTCATCTa
cctcctcggcctcctcctcttcatcctcgtcgtcgtcgtcgtcgtcgtcgctaccTTCCTCCTGCTGTTCCGCTGCTAGCTTCTCACCTGCAATCGCAAA
CAATAAGTCAGATCTCCACCGCTCTGTCAAAAGACTCCTCATCTTCCCAGACGTACGCAGGatctcgacgatggcgtGCTGCGTGCGCCTCTCCAGCTTG
CGTAGCATGGGTGCGAGGTCGCGCTCGATGTCCCAGTTGGCGCGCTTGGGCGCGAGGTTCAGtagttcgtcgtcgctctcgtcctcggtCTTGgcatcct
cctcctgcgcctgcgccaccttctccgcGAGGTCCTCGGAATTGTCGTCGGTCTTGGCCGAGGCGTCGGCCCTgtcggcctcttcctcctgcaTCGGCTC
ATCCGCAGCATACTTCAAGGCCTTTGCAACTAGAGTTCCGGCCTCTCCACTGTCGCTCTCGCCGTGCTCCTTGCGGGCTTtggcctcgcgcagcagcttc
agccgctTGGCGCGGGGCATCGCATCGTCGGCATCGGTGCCTGCCAT