Description :
From Genome Similarity Track
Location :
Scaffold_15:37448- 42785
Transcript NameFunction/comments
Hyaar_Emoy2802749glutathione S-transferase, putative
Hyaar_Emoy2802750glutathione S-transferase, putative

Sequence
5337 bases(100 bases per row)
TTCAGCGTCCCTCTGTCATCCTCTACGGAGCTTCTCACGGATCAAATGAAGGGGGATTTTAACTTGGAGACGCAGCGCCGTCTTCGTAGTAAACACGTCA
GTGCTCCGGATGATTGGACTGGATCTGATACGACTCGAGTCATGCAGGATCAATTGTGTCATCTAAAGCGGCGATGCGCCAAATTGGAGCGGAAACTGCA
GGAGAAGGAGTCGATGATTCAGTCATTGCAAGAGCAACAACAGCTGCAGTTTCCGCTATTGGTGCACGAGACAATGCGCAATTTGAATTTAATGGACAGT
AATGAGTCTGTTCGACAACGACCAGCTAACGACGGGGTGGGGCGATCGTTGTTTTGAGTAACAACCAATTGTGAATTTAGTCATGAATTCTGATTCTACT
GTGTGGTCTTTTCTGCGTAGCCACTTTCGCATTCTGTTATGAGCGTCATGGCTCATAGCAGGCAAGACATTGATGTCTGCATTCACGAGTACGAGCAGCA
GGTGAGTTTTCGTATGTATGGATTTGCAGTTTGAAGGAAGAGATGCGCGAGAACCGTGATCGTTAAGATGTATTTATATCTTGGAAGATCGCAAAGCTTT
ATGAGGAGAACCGGAACGAAAAGCTGAAGAACGAGATGTTGAGTGAATGTCTTCGCGATCAGAAACACGCCAAGTCAAAATTCATGAAAGCGTGTAGACA
AGCAAAACAAGAACTTCAAGCAGTTAAAGATAGCGGGCTAAGCCAAATGCTGGTGGATATCGAGGCAAGGTGCAGTGCGCTGGAGAAGAAGAAGGATAAC
ATGACAGACGAGCTCTTGGTGGAGATATCTTTGGTATGGTTGATACTTGTGCTGGATAAGACGGCTGGGTGTGAGGCCTGACGTGATGTTCACTATTTGT
TATCGAACAAGCGCAAAAAATACGAATCAGAAAAAGTCGTTGTTGCCAATCATCTGGAGGAGTTACGTTGCCAGTCTACGAAATGGGAGGGCAAGTGTGC
ATATGCATGTGCTGTAACGTACAATGCACTCAGATGTTGTTGTAGGCATTGTTGCTAGGAATAACGAAATGTTGCAGCACGCGCGGGATCAGATATGCGA
GCAACAGCTGATGATCGAGAACTTAACAACTGACCTAAAGCTCGCAGATCGTAATACTGCACGTCCGTCTGATCACTTCCACGATTGCGATAACGCAGAG
ATAGAGGTAATTTGTTCCTATTCTGTGTTTCTACATGTCTATTGCTTTTTACATGCTGTGTGCGTATTGCTAATGGAATGCTTAATCTATTTTTCTTTTC
TTCATCAGATAGGACGACTGAAGCACATTGTAAATACGGAACAGGTAGCTTCACACGAAACAAAACAACGCTTTAGTCGATTTACAGAAGAGAACGATAT
GCAAGGACAAGGACAGCGTGCTTTCGATGACGAATCTGGTTCCTCCGAAGAGCACGTAGCTCCGTGTGCAGCTCAGAATACTTTTGATCGAGTGCTCATT
CAGGTGTGGTTTGTGTGTCATCCTCTCACCATAACGTGTGCTGATTCGGATACAAATTTGTTCTACTGTGTTGGCTGGGAGCAGATTCAGCATCTACAGT
GCAAGCTGCGCTCATTGAGAGACCAGTTGAAACAGTACGAAGAAACGAATTTCATTGACGTCAACGCACTCGATGAAGAGAATTGGTTTCAAGAAGAGTT
TGCTCAGGGCAGTGCCCGCTCGTGTGTGGAGTATGCGACACATTTATCCAAGTCTGTAGTTAAATCAGCTCGCTATCTCTTGGAGTTGCAGCAGATCGTC
GAAGATGTTGGTGCTCGACTGATGGGAGAATCTTGTGCCTTGCAATAAGCGGATGCTGCAACCGGGTGTGTAATATATATTCGCGAGTGTCACCGATGCT
GCGATTGAGATTGTTTCCGCTTTCACGTAAGCACAATGCCCAGAACTACTATCGGTTTACTAAAAAATTAGTATAAACTGTACTAGGCATGAATTATTCT
ACAAACGTTTTTTGCGCTAAAACTCACCGTGTCTTATCGACTAGTGTCCAGTGCAGTCCCACACAAGTCTAAACAAATACTCACTTGTCTTTATACTGGC
GGCAATACACATCCGGTTCGAATGGCTGCTTTAGGCCCATGATGGGGTATTTACGCTGAAAAGTGCGTCGTGATGTATAATACTAGATCCCCAATCAATT
ACCATGATCTCGTTGTACCCTCTAAGGCGAACCCCATCCATGAGGGGCGTCACAGACGATACCGCGTCAACCCAAAGAGTCCAACCGTACCAACCACTAT
TGAACCTGCTGCGTAAACAACTGTGTGGCTGTTTCAAACCCGATCTACGTTGTGCAGTAGCACGAGACACGTTCAATCGCAAAGAAGATCCTTTATCTTA
CCAAGACTGTAGAAGAAATTGGATCCGAAAGGCAAAGAATTTTTTTTGCCTTGCACATTGTAATGAGTCACATATCTGCTCATGTATTAAATTGATTCAC
GTTTCAATCGACCAGCGTAATCGCCGTCGACACCTTTCGGCAAATTATATAAGTGCATGACTGTTCGTTACGAATAATAATTGATCTGAAGTTGCTTCTC
AAAATGGACTTGGATATGCGATAGTTATTGTTGCAATAGATTACGTGAGTATAAAATGCTGAAATGTTTACATGAGACTGCTTCTGCAAAGACGGCTTTC
TGGAGGGTATCAACGACGCGATAAGAAGCTCTCGGGTGCCTATTATTCTCTAGCTACCGAATTGTACAAATTCGGTAGCTGTATGCCTTCTAAGACCATA
TATTTGCGCGAGTATATGGGTAGGCACGACTGTAAATTATCGGTTTGGAAGCAACACCTGCCCTCTCGCACCACTAAGAACTAAAAATCACCAATTGTTC
GTCCACTTTTATATTCGCAAAAAGTTAGCTTTTGTAACTCTTATAACACTCATCAGAAGTTATCATCCTTTTGTAAGATTAAGAGTTCAGTTCCACTTGT
CCATCAATAATAACAAAGACACACTGTAGCTCCCCATTTGGTAGAAAACAATGAACCAGGTTGGAGCCGTCGCTGTCACCGCCGTGCTCGTGGCGCTCTA
CCACAACTTTCTCGTCCCGCAACTTGTCAACCACAATGGGCCACCGAAACTAAAACTCACGTACTTTGCTGGTCCTGGACGTGCCGAACTCTCGCGCCTC
ATTTTGTCAGCAGGCAACGTGTCGTTCGAGGACGAACGCCTGAACCGTGACGAGTTTATGGCTATTAAGCCCATGCTTCCCCTTGGTCAAGTACCAGTGC
TAGAGGTACACGGGACGACATACAGCCAGAGTATGGCCATAGCTCGTTATGCTGCGAAGCTCGGTGGGTTGTACCCCCAAGATCCAATCGAGTGTCTGCG
TGTGGACATGGTGTCCGAGTCCCTCGTTGACGTCAAGTCGCTCCTCTCAGAGATCGCGTACCGCACTCCGGACGAGACTCAAAAGGCAGAAAAGACCAAG
AAACTGCTGGAAGAGCTGGTGCCCAAGACACTGACACTACTCGAAGGATTCGTGCAGCGCCCCTTCTTCCTGGGCCACGAGATGACGTATGCAGACTTGC
AGCTTTTTGATCTCGTCAAGAACGGCCTTGATAAGTACCCGACCTTTAGTTTGGCAAAGTATTCAAACTTGACGACGCTCGTGGCCGACGTGGAGACGAA
TGCCAACGTGGCGGCTTACCTGGCCAAGAAGCATGAGTAAAGTGGGTTGATTCGAATGCTCTAGTGCTCACAATGGTTGTAAATGTTGCTTCTAGTAGTC
TTATTGTTTTTACTTGAAGCTACTTTACTGACAGGATGACGCGTATGCTTAACAGTAGCCACGATTTTGTCGTTTGATTCGACCATGTAATCGCAGCATT
AGTATTCAGGACACCATAGCCTGACCATGTCAATTAAGCTTGTTACTCCACGTCAATTAAGCTTGATACTCCTACTTGAACGAAAAGAGGGTCGCAGAAA
TGCTAGACAGATTTTTAACTACAGTGGCATAGCGTTCGCAGTCCACTGCATCGCGCGCATCGGCTTTTGCCGGTACTTAGTCATAGCACTTTCAGGGATG
TGACAAAACTGACTACACTTGTTGCTCGCTGGAGCCGCCACGTAAGCAGATTTGAGCTATCTAGTGTTGATAAAAACGCAAGACCGGCCTGACAATTAGC
AGTGGGTTAGAAGTACAATGGCCTCGCGTAATATGCTGTTCTCGTGAATTTGACCTTAGCTATTGTATAGTTTATCAACATTTTGTCCAGTCAAGAAAAG
CGGACGACTTCAATTCACAATTTGCACCTGCTCGCCATGATCTGTACGTGGCTCTCTGTAACGCTTTCGCTCAAAGTTGACACTTCTGCTTTATCTGAAC
TTACGGGTCGAGTAGTCGTCGTTTTTGCTCTCTTCAATAACATAGCAAACCATCAACAAATCCTTATAAACCAATGTGGAAACCAAGTGCTTTGCAACTT
ACCTTGCCTGGACGTCTATCAATTGGAGTGCGTAACGCATCGGAGAGGCGAGTAAAAATTATAAAAGTCGTTTGTCCGACTCAATTGCAAAACCTGATCT
CATGATCTGGCCCGGTGACAGCAACTTGATGAAGTCGACATCCACGTTCCATAATCTCAGTAGCATATTGTCACGGGCTTAAATGAGGTAAGGGATAATG
TGACACGATGTCAAGGACCTTGTAGTCCTCGCTGGACATGCGAGCTTGTGCCCAACTTACTCATGTAAATCGTGCGATTGCTTACGGCTCAGGAATTGAC
CTTATAACTTACAAATGCGTATTCTCGCTTAGACTCTCAGACCTTAATCAAGTATTGAAGGTGGACACGTCCCGGCCAACATCGACTACCATGTGGACTT
GGTCCTTGACTACAGGTAGTGCGATCAGCAGCTGTCGAGACTAACAGCATGATCGATGCGGGCACAATTATTATGGACATTGTACCGACCTCAGTGTTTT
AAGTCTCTGGTACAGTCACAAACCACTTTGATGAGAAACCACACGTTTTATGCCGACGCAAGTGCTTTGCGAGGAAGGGGACTATTTCGAGCTCTAGTAG
CGAATCTCTAGCAATTGCATCGAGTTTCAAGACTGCAAGAGCCAAAAAGGTGCTTCATGACAAGTGATGGTTGTTGGCTCGTTCAAGCCATCTATCATGG
TTGACTTTTTGCATCAGGCACGGTATCGATCATCCCCAGCCTTTTAGCTTGTTTTACGCGACAGCATGCGTAATCGGCTGCCTACAGCTCCCATCTGTGG
TAATCAGCATAAGTACCGGTACCCTGAACACCGTGCT