Description :
From Genome Similarity Track
Location :
Scaffold_33:374456- 376188
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G010893Protein of unknown function

Sequence
1732 bases(100 bases per row)
GTAAGTCTAACAGCAGTGCTCTAGCTTTTCCCAATCGCTCCCATACTGTCGGTGAACAAATCCGACAGAAGGTCTTCTTCGTTCGAGTACGATCGTCTGC
TAAGTCGCTCGGCGTGCGACTGTTTCCGTCGGATAAAGCTGTCAAACATGCTCACATCGAGCTCCTTGTTACTTCGCAACGACGCGTCTTCGAGGTACGA
CGTGCTGATCGTGCTCTCGTCGACTAGCATGGTCGAATACGTCGACGACAGCTCCGAGTCCAATGGACCGCGCACTCCCGAGAAATGGAACACGTAGTCG
AAGAACACCGGCGGTTGCTCGTTCGGCGCGCTGCTGCCATCCCACTCTATCGCGGATCCGCGTTGCTTGGCCACGGCATCAAGACAGCTTCGGCAGAAGC
GATCACGCAGCAGCCGCCCTGCTTTGTCGAGCTCGAAAAAAAATTTCTCCTCGGAACATCCCTTGCAAACGTTCTGCCAGTTGCACAGATTGAGTTAAAT
AACAGGAAATGGTTAGTTTAGGCGTTCATCATATCGAAGTGCCTCTCTCTCTCTTTCTCTCTCTCTGTTTACTCACCTGTACGCACCCGCCACAGAGCTG
GTGGGAGTTAAAGAAACTTCGGCGCTCTTCGCAAATATAACACACGTTGCTACAGTAGTATCAGGAGAAAATATCAGAGAGATTCATCGTGTCCCATGCA
CTGCAGGTGTATCTATCAACGTACATGTCCGAGATCGTGATGGAGCTCGTGCTCGCTCGTGTGTGGGCGCGCTTCCGCAATTGCGATAGCTTTCTCGCTT
CGGACGCCTTGACGAAGTTGACGACCGAAATCCACTTGCCCGCCATGGCAAAGTTCGAAATGAGCGTTGGGAAGCTCCCACTGTCAAAGAACTCGCCCCA
GAAGAACGTCTCGACCTGCTTGCCCTTACGTTTGTACAGGTAGCACGTCGACATGTGCGCGCGAATCAAGCCTTTGAATGTGTTGGCAGGCCACTCGGGA
CGGTCGACGGACTGCAACAAGTGGTAGCCGATCTCATTGCCTGCAGCATCAAAGGTGATCCCTTGTCGCTCGTACGTGAGCATATCGCGATCGTACGAGA
CCGCACCGCCTGGAGTCTTTGCCGCAAACCACTTGATGCCTGCGAAGTTGAATCGATCGTCGGGCGTGCGCCGTTCGCTGACCTGCATGATCGATCCGGC
GATGAACTTGGCCTTGAGGAAAGTCAGTACCGTGCGCAGCTCCTGCGTGTTCTCACTGTACAAGCCGTCCATGATGTCTTCCAGGTAGCAGTCTACCTTA
CCGATACCGAGCATGCGCGTTACGCGAGGGTCGCCTGTACCGCGCAGGTCCTTGAAGATCGCCATATCGCTGTTCTTGCGCACTGGCGCCCAGAGGCGGC
AGTCGAGCTCGCCCTTGCTGCTGTACTTGGTGTACTCCTGCACCCCAGCATAGAGCAATCGGCCGACTACACGATCGTAATGCGCCTGTTCTTCTGGCGT
GAGCTCGATTTTCGGGAACGGCTTGGTGGTCGTCGGGTCCACTGGGAGCGGGAGCGCGTGGCTCCGCGCCTTCATGTACGCGGCATGCGTTGCGGTGTAC
GACGTGGAGGCTGCGACCGGCGGACGAGGCGGCGTGGACCAGCTTCGCGTGGACGACGAACGCGATGACGACGAGCTCGAGGCACTCATGATAACACAGT
TGCAGGGGCAATGAGCAAAGTAATAAATGAAT