Description :
From Genome Similarity Track
Location :
Scaffold_698:3744- 5379
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_698-fgenesh-gene-0.0Protein pianissimo A

Sequence
1635 bases(100 bases per row)
GGAACAACCTCAAGGCGAGCAACCAGCGATCGCTCTGGGGGCTCGAGTGGCTCTACCGCATGCCGTGGAACATGGAAGTCAAGATTGTGGGACCACCAGG
CAGTGGCCCACCGTCCAACCTTACCTTGGAGACGTATATTGACGGCTCGATCCGTGATGAAGAAGACACGCCACTGGACGAAGACGACCTGCGGATGAAC
TCGATTCGCGTGAAGGGCATCGTCGTGGACGCGCGCAATATGCCGCAGCCAGTGATTGTGAATTCGCAGCAGACGCTCCAGGCTTGTTTGTTTCTGGGCA
CGCAACCCGTGGACCGCCGCGGGTTCACCAAGCCGCCGCCGCAGAGTAACGGTGGCTTCGTCATGTCGTCCAATCTGACGGCGGACCCACAGCTCAAGGC
TGCGTCACGCGCGCGCACGCAGTCAGCTGCCGGCGGTGGAGGCGAGCGCCTTTCGGAAACGTTTTCTAGTGCATTGGACTACCAGAATGACGCGTCGATC
CCGCAGCCCGAGGCCGCGTCGGACGAGAACAAGGACTGGAGCGTGTGCTCGCCCGACCAACGGTCCCCTCAGAATCTCTCGAGCCCCGAGACATCGCTGT
GCGGCACGGGCGAGCGTGCCGTGTGGAACTTCCGCGTCGAAATGGACCAAGCGACAGGCGGCGTCAAGCGACTCATGCTCAAGTCGGTCGAGTTTACGCT
CCAGCTGCTGCCTCTGCGGCCGCGCACGGTGCCGCTCCCTCCCCATCTCTATGGAGAGCTCGCCAAAACCACGCAAGGGTGCCAGATCTTGTTGGAATCG
GGCCATATCCCGGAATTCATTTCGTGTCTGCGCGATGCCGCCAGTGTGCCACTGGAAAAGCGAGCCGCGTTGTGGGCGTTGGGCCACGTCGCTGCGACCT
CGAGGGGCTACGATCTCATTTACCACTATGCCCACGACGTGCTGGATTTGATTGTCAAGCTGGCGACTGACTCACCGATCGTGTCGATCCGTGGGACCTG
CTTTTTTGTGTTGGGGCTGGTCGCGCGGTCGTCAGCCGGACGCCGTAACCTCGCGCGGCTCGGCTGGGACACGGCCCGCGACACGCAGTGCTCAATCTCA
GTGCCTCAGAACTGCAATTCGCTGTTTGTGTGGCCACAGCCGCCCGCGCACGGCGCCTCGAGCGCTGTCTGCAACGTGACGCACCCACCGGCGTCGCATC
TCCAGACACTGCTCAGCAAAGTGCCGCCCGAGTGGAAAGACGTGCTTCGCCTCGTCGCGGATCTGAGCAACCACATCACGCAAAAGGAAGCGCACGCGTC
ACTCAACAAGTTGCGTGCGTCCAAGTCGAGTCTTTTTGAAGAGCCCATGTTACTGCTGTATGTGCACGCGCTGCTTGAGCGATACAATTACCGACTCGCG
CTTCGCCAGTTCGTTCTCAATTCGTTTGATCGCGCCGTGCTGACGGACGAGGTCTTGGACTCCATCAATCAAGACGAGAGTGGAGGCGGCTACAAGACGA
ACGCTGGCGACAAGGTGCCCCATCCACGGGATGTGCTGCGACGCCGGTCGTCCCCAACGATCCCGTCGTTTACGGCGTCCGTGCAGTCGCTAAACTCTGT
AATCCAGGGTGGCAATGCGCGCATGTCGACGACCA