Description :
From Genome Similarity Track
Location :
Scaffold_155:37439- 43928
Transcript NameFunction/comments
Phymu_g5671conserved hypothetical protein
Phymu_g5672metalloprotease family M48X, putative
Phymu_g5673conserved hypothetical protein
Phymu_g5674hypothetical protein

Sequence
6489 bases(100 bases per row)
TTGCGATCCGACAGTACTTTCACCGGATTCATAAAGCTGCTCGAACATATCGACACCGTTCATGATGCCGAGGAACTTGACagccggagctgcagcagcc
caCCGCAGAAAAAAGTGGAGCACCTCCTTAACTGTAGGCTGCATGCGCACCGGAAGCCTCAGTAGCTGGtccacttcatccagcaccacgacgatCGAGT
GTTTCTTCGTCCTTGGTGCTCGCCGTTGCGTTGAAACAAACTTGTCCATCTCAAACGGGTCCAATTTCTCTGAGACCTTCCAGTTCGTGGCCTTTTTCAC
TAGCTGAATCACTGCCGCGTACAGATCAGCAGGATCCGTAAAAGTACTGCAGTTAATCTTCACTGCTGTCTTGGTCCACTTTGCAACAcgcttccgcttc
aacatcgcgCCGTTTTCCACCGTTTCATAACCCTGTTCGACCAGCAATTGATTCACTGACGAACTTTTGCCTGTTCCAGGGGGGCCAATGATGAACAGAC
TAGAACTCTGCTCCCCCTTGCCATTCAGCACGTCACGAACGATCTGGTGCTCCTCCACACGGCCGACAATTGGCGAATCATTGCGCAGAATCTGTCCGGA
GCATATCCGCTGCAGTACCGTCCGAGAGTCCTCCGTAAGCTCCGGAATGGCAGGGGTCGAGTACTGCAGAGTTCTACGGAGAGCCACGCGCTTGATGGTG
CTTGGTCTGGTCTCTGCGGGCTTTTCAGGGGTCTTGAGGACGTTCAACATGGAAACACGAGGCTTAGGGTGGTGCGGTGTCAGTAGTAAGGGGGAAGCAG
AGATGTCATCggtcttgcgcttcttcggGGCAGGCGGACTCAGTGGCGCAGAAGGGGAAACGGAGGCGGAGGAAGTCTCGAGCGCgcggagacggcgctg
cagttgctgcgcCAGCTCCGGCATGTGTTCGCGCTTCTGGGCTCGAGTGCGCATAGTTTAAGGGGGACACAGCACGGCACAGACACACGTAAAAGGACAC
GAACACTTGACCAGGCAAATTCGGAACTGGCGATCGAATGGCGCCAAATGCAAAATGGCGCGAAAAATCGTTTTGGCGAATGGGAATGGAGAAGTGTTTT
GATTGGATGAATAAGAGGGAGAGAGGATACCGGTAAATGTTGCAAAGAATACAAGAAAATCGGAAGATACCGGTATAGATTCATAATTTACAAAAGTGTC
CAAAAACTGTAGTTGTAGAGCTCAGCTAAatgtcgtcactgctgtcgtcctcgATCACGAGCTTGATTGTCTCCGCGGTAGTCAAGAGTTTGAGTCGTTC
GATACGCGATGTCAGCAGCGGATGAGAAGTATCGCCCAGGTAGTTGCCCTTTTCAGTGATCATCCACGTGTTGAGTACCGAGCGCATCTCGCAGTTGCGG
GACAGTTTCCGCTGGAAACAGTTAATGCCACCACGAGCGAAGCCACTCTCGGCGGCCACCTGGTCGGCCTCGTGTTCCAAGCTCCAGGATAGGTAGAGGT
TACCGACAACGATCCCCAGAACGCCGACGGCTCCAGCGACAAGTTTGTTGGGGATCTTGTGAATGGCGACGCAGCTGCCGACGAGTGACGCCGGCAGGAA
GGCACCCGTGTACATGGCATGGTTCTTGGCAATGTGTGCGCTTTCGTGCGCCAACACAAAGTCGATCTCGTCGCGCTTGGGgatgtcgtacttggcgtGT
AAGTGTGCCGGCGCGTAGAATGCGTCGTATAGCTCCATGGGCAGCACGATACATGCTCCACGTTGACCGACAGTAAGATTTGCCCCCATTGAGGCACCCG
CTGACTGCTCACCGACGCGGATGGAGATCCTCTCCGGGTTCTTCACGCCCACACGAGCTGCGATTTTCCTCACGTTGACAGCGAAAGGGTCTTTGCGGTC
AAGTTCGTGTGCATCCAGACCTTGAGCCAACCGCAACGAGTGTGTGCTGGTAGGTTCCGCGATCGGATACGACGCGTATCCGTAGAGCAGCAGTGCCGAG
GCACCGATGAACCGCTTCGAGTACAGAGCTGTCGACATGAGTTTGATCGTCGCTCGGGTGGCCAATTTCCAAATGGGCTCGCCATCAGGAATCTGCGGTG
GTGCAAGCTTCATACTTGTATCGGATATTACTTGGACGTGCGCGTTTTTCAGTCAATTCGGCGGTCCACTCCCCGTGTGTCTTTGCTTCACCGCAAATGC
CTTGGAATTGTATGCTGCTCGCTTTTTTGCTGCCGTCGATTTGCCGTTTCGTGTCTGGCGCGCCGATCGATGAAGGTTCAAATTGCAGGAATCCGAACTA
CAGTCCGCAGTCCTTGCACACCGAGATGCCAGCCAATGCAGCAGTGTCGACCTCGCCGCTACAAATACTCCGCCACGTTCCTGAGGCGGAGAATTCCTGT
TTGGGGTGGCACGCGCAATGCACTTGCTAACGCGCAACGTTCGATTGACAGAGGCCAGTGAAATCACATTGGCCTAGCCCTAggattggctgaaatttGC
ATTGTCGCAGGATgaactgtagccatcttggtGATCAACATGGACTGTTATTTCCAGCAACTTTAACCTGAGGACTCCACAGCGAGCCCCCACCTCTACG
AAAGCAGCATTCATTGCGACTTTATGACTGTTGCTTCACTGGATAACGGAAGTCTTGCTTGCCGTATTTGCAATACGGACAGTGTTTGTTTGCTATGTAG
TCAGGAGAATGTCGGTCTTCTTCAGTCAGTGGACTTCGACACGTAAAGCAGGACACCACCGATGCCTCTGTGAGATCCGGTTTGAGGGCCACACGGTCAT
CGAAGATGTAGCAGTCGCCCTTGTAGTGCGCACCACCCACCTTTTCAAAGTACTTGAGGATGCCGCCGTCCAGTTGATAAACCTCCCTGTGCCCCTCGTT
CAGCAATGCGTATGATGCCTTCTCACACCGCACACCGCCAGTACAGAACATCACGATAGGTTTCTCCTTTGGAACTTGCTGTAGCtgtgctcgagcttct
tctgggAATGCACGGAAGCTCTTAATGTTCAGGTCCACTGCGTTCTCAAATGTCCCCAGTCTCACTTCATAGTCGTTTCTGAATCACAAAAACGCACGAA
CGTCAGCTATTCGGTTTCCAGCACCAAACCACAAATACACTGAACTGCTGCACCTTgtgtccagcaccaccatATCCTTCCTGTCGTCCATCCACGTCTT
AAACTCTTCCGCTGAAATATGAGCTGCCAGTCCATCCACAGCAGGGCTGACCTCCTCCATGCCCATAGAGATCACCTCCTTCTTAATCTTCACCAGCATT
CTCGGCAGCGTCATGCGGTCCGAGAAGGAGTCCTTGAATTCCAGTCCTCGGATCTCCGAGTGTAGTCCAGTGACCACGGCTTTCATGGCTTCCACAGGTT
CCGGCCTCCCCGATAGTCGAATATTCAGTCCTTCTGTAGACAACAAAATCGTGCCACGAAGCTGGTCCTCTCCGAAACGCGCGGCAGTCTCTAGCAGCTG
TTGTTTAAGCTCAGGCAGGCGCTCTGCGGCAAACACGCAGAAGCCATAGGCCGAcgagttcacgtacagcaccttcgtCTGTTCTTCATCCATCGCGCAC
GACCTTTCCTAGCCTTCCATTTAACACAAGTCTTCTATTTAGATGTatgcggtacatgtatcccTAAGTTGAagatatttttttttctctcaTCATTTTG
CCAGTAGGGAAATTGCCACTCATCAATCACTTCTTGATACGCATCGAAGCAGTCAAGTAATGGGCCCCCGAAACTGGATGGAGACGCCCagcgtggtgct
ggacgagaagcgtctgctgcacAACATCGAGCGGATGCAGGCGCTGGCCACGGCGAACCATGTGAATCTCCGCCCGCACGCCAAGACGCACAAGACCCGG
GAGATCGCGACGATGCAActggcagctggagcttgtggccTCACAGTCTCAAAGCCGTCCGAAGCGCTGCAATTCTTACGTGGTGACGTGCCGGGACTCA
AGAGCGTGACGCTGGCGTATCCGGTGGTGCAGATTAACAAGGTGGCGGAGGTCGTCAAGGCGGCACAGACGGCTGACGTGGAGTTCTTGCTGACAGTCGA
CAGCCCCGAAGGAGTGGACGCTGCGCAGAAGGCGGCGGAAGCTTGTGGTTCCACTTTGAAGCTCCTGATCCACGTTGATGTGGGATACCATCGCGTGGGT
ATTGAAGAAAACGACGCGAAGCTACTGCAACTGGCTCAGCGGATTGACAAAACCAGTAGTCTCGAGTTTTGTGGACTGCTGTCGCATGCAGGTCACGCAT
ACCGCTGCAAGTCGGTAGCTGAATGTtcggaggtggcggagaCGGAGAGGCAAATCGTTGTTCGCATCAAGTCCACGCTGGAGTCAAACGGAATCGCTGT
TCCGGTTGTGTCTGTGGGAAGTACGCTCACGGAAACTGCTCGGGAAAACTTTGAGGGCATTACTGAGATTCGTCCCGGCAACTACGTGTTCTTGGATCGC
ACCCCCGTTCGTATGGGCCTGTTTTCCGTGCAAGATGTGGCGCTGACGGTTCTTGCGACGGTCGTGAGCTCCAACAATTACAACTTCATCGTTGACGCCG
GGTCGAAGGTGCTCAGTTCTGATGGCGCGCGGTCAGCTGGCGACTTTGGCTCTTCGTGCTTTGGCCTCGCCTTTTACGAGAAGGATTTTGAGCGAGTGGT
GAAGGAACCGACGCAAAACAAGTCCGTGCTCGACGACGGTAAGGAGCTCATCTGCTTCGAGGTGACCAGTCTGTCAGAGGAGCATGGTtgggtgaagaag
atcgtgggCATTCCTTCACCTGCCATTGGTGAACGTCTCGTCATCGTCCCAAACCACGCGTGCGTGGTGTCGAATCTCACGAACAAGTTTTACATTCAGG
GCGAGAAGCCAAAGAGCTGGGCTCTCTTGTCTCGCGGATGCACTCAGTGATAAAGCACTGCATCTCATCTACAGATCGGATAAAAAGATAGTTCCATTAA
AAACCACTTTAAACGATCTCACGCTTCTCATCTTCCTCCCCCTGCCTGTGGTTTGGAGCAATTCACCGTTTGTGCCGCCGTATTTGTCTCGGAAGCAACG
CAGGCCGCAACTCACAACACAGACGTGATGCACTTAACGCATCTTGATAACCCCACAATCCTTCTCGAAGGGTATCGTGTATTTCCAATAGCAGCTTCGC
GGATGAGCGAAATGTCGGTACGAATGGCTTCAAACCTCGTGCGAAGATTCCGCCGGAGAGGGGACCAATTGTCATTTAAATATCAGCTTTTAAACATTCC
AGGTTGAAAGAAAGTCAACATGCCAATTGGGAACACACTCGAATACGTACGCTTTGTACGCGCATTTCGCGGGTGCGTTGTTACTCACAAATTATTGTGA
GTCACAATAGGGAAAGTCCTCAACTCTATTAACTTCTGCACGTATGCATGGCACCATGTTGTGGTAAGCGAAATttgataccggtacagaCTTTATTCGT
ACTGCGATATGTAGCTCTCGAATcgtggcaaattgccacaGACAATTAAGGGTGCGTTCGGTAGAACCTCAGCCTGTGAGGCCTCTACGAACATCATGAC
TCGTAAAATTGCCTCAATTCTTCAGTACCGGTACCATACATACTGTAAGCGCTTTGCCACTGCCGATCACCTGGGATGATGCCGCTGGCTGTGCTCCTTC
GACGCTGCGCTCGCTCGTTCCACATTGAAGTCGACGCCAAAAGCTATTTCGCGATAGAGGCGGAGGGTACTGCTGCCAGTGGCACCCTCCGCCTCGGAAT
CGTTGAGTCATTGCCGCGCTCAGCCACTTTTCTACTATACGGCGCCAAACATTTGTCATGCCAAATTACTGTATTCCGTCGCCGTTTAGGTTGACGGGCA
CTAAAGTTTGTACAAAGCTGCCTTTTTACAACGTCGCGGTAGTTTTGGTCTTCGCTACTGTGATTGGCCGAAACGCTAATCCAATTGCGCCATGTTATCT
CCTCCCATTGGCGGAAATCTCGCCACCCACGTTTTTGACTGAGAGACGGACGCCGACTATCGAGCAGAGGAGATTCAAGGAAGTGCCTCCACACCCCCTT
CCTCTCGCCATGGCGCACGACCGCGCGGCCGCTGTGACCGCGTCTACGGCGCGCGTGGGGCCGCCACTGCTCGTGGCGCGCAACTTGCTGCCTTCgaccg
ccagcagcagcagcagcgtcagtgccagcaccacaagcGTCATGAGCTCGTCCTCGGCCTCGTCCGTCGCCACTTTAGGCACGCGCAGTGCCGTCAGCGC
TAGAAGACGAGATCGAAAGTATGTAGGGGACGCGGCGGCTACAgcgacgtcctcctcgacgCTATCCACTGCGTCCTCGGTGGACGTttcgtccaccacc
acggGGGTGTCTGCAGCGGAAACGGCACGCGCACGACGTCATACGCACCACAGTCAAGATATCCACGACCCTAAGAGTGGCAGGCGGCG