Description :
From Genome Similarity Track
Location :
Scaffold_72:37430- 45231
Transcript NameFunction/comments
Physo_139238hypothetical protein
Physo_139239hypothetical protein
Physo_109192putative endo-1,3;1,4-beta-glucanase
Physo_139241hypothetical protein

Sequence
7801 bases(100 bases per row)
AAGAACTTCACTCCATTCACGAATACCTCTGATGCCTGAAATCTGCTTTTCGTGACGTGTTGATCCAACAACTTTCAGCCCTGCAGGGTAATGTTTGACG
CAGGTTCAGCCAGAATCGCATCTTCACCCTCGCAAATGTCCTTCAGACCTTCAACAGCGTAACTGTTTGCTCCAGCCAACATGAACGAGGACAGTTTGTT
GACAAAATTCACTTTGGAGAAGTCAACGCTGCCGGTGGCGACAATGTCAGAAACGCGGAGGGCGTTGCCGGTGCATTCGCTGCCGTCGTAGAACACGAAG
CGATAGCCATGAGTAGCCTTCAACCAAGCAGCACGGACCGCAATGTTGCCGTAGCAGGAGTCGAGCGAGTAGCACACTTGGGTCTCGGAGAAGGTGAACT
TCTTGTAGCGAGGGTTGAGTGACGTGGGTTGCTTCGGAAACAGTCGGAGCTCCACAGCAGAACTTAGGCACAGGAGGGAAGCCACAAGCGCGACGGCGAG
CAGCAACACGGTGGAGGTTGGCATGGACATCCCGGATGCAAATTGCAGAATGACCTGAAATACAAGGTTCGGATCTTCAGAACAAGTCATGTCTGTCTGG
TATATCCTACTCAAAGCCAAGGCCCTGTCGTCATTCACGTGAATCTTCGCGCCAGCAAAGGGTCCGTAAATTGTGGACAAGGCGCTTGGACCTTGGATGC
TTCGGCGCTTTTGCTACGGGCTAAAGTGCGTTATCCCCATTTCCAGATAGCCCACGACCCGACTAAAGCTCATGCACACGTTTGCTGCGTCGTTGACGGT
CGTCATCGTAGCGATTGCCACTGCGATCATGTCGACTGATGCCGGTCATATCTACCTATATGACGGCCCCAATATCGATGGCTACTACCTGGATTGGGCG
TTCCACGATACCCAGCACTGCTACTCGGTGCCATTCGATCATATTCAGGAAGCTACCCGACGGCGGCCATTTGGTCCTGTACGAAGAAACTGAGTGCCAA
GGCAAGTACTACAAGGTCGCTGCGACGCCGCGCGGGACGCTCAAGTACAAGGACGGAGGGTTTGAGATCGGCGTTTCGTCCTTCATGGTTTGGTCGTCGG
GGATATACGCCACGAACGGGTTGACCAATATCTGCGAGGATCACGACACAGAGAGGCTTGCGATCAACTCGACTGCTAGCGTACTGGACAATGCTGGGCG
TTGAGAAGGAGAGAATCGAGTAAAGCAGTGAATTTACAGAGTCTATTGTGTCATTTGCACTCCGAACTTGCTATCAGGCTTTCCGGTCCAGCGGACATGA
GTTCTTCTATCGTACGCTCCGGTGTAGAATAGCCTACGATCTTCGCTGGGCTTTCCAAGATCCCCTCCTTCCACGTCTTGAACGCCGAGACTTCCCCCGC
CATGCCGACCGCTTCGTCAAAGAAGTTGATGTTACCATTGGCGACCGTAGGAGTAGCTACGGGCTTGCCGGTACAGGACGCGTCATCGTAAAACACGAGC
TGATCTCCGGTCGGGAGCTTCGTCCAGATCGCGGAGTGAGCGCGGTCATTGAAGCAGGTCTTGAGCGAGACGCACGCTCCCAGCTTTGTCGAGTTGAATT
TGATTGCGGAGTGGAACGTAACATCCCCTTCAAGCAGCCAAACCTCAGTCGATTCGCACACCACCATAGCAAGCACCCACACAGACGCTGCAGCGAGGAA
ACGCATTTACTGGTTCAGTGAAAAAGTAGAATTTGCAATAGCCGAAGGGGCTGATATCACCGCGATCCTAATACTAGGTGGCTCACAATGCCGCGACACT
AAATTATGTGTGGATCCGCTGGCGGCGGGCCGCAGCATTTACATTATAGAACCCCGCAAAGCTTGTGGCAAAGACGAAGAATGCCCAGAAGCAGCTCTGC
TCTGTCAAGCAAAAATTTCTTTACTTGAATCACTCTCGTCTTTGGTGGCGGCACTATCCTGGTTCTGCCAGGCAGCTTCGGGTTCATGTCCAAGGTCTTC
GGGTGAACCAGGCGTATCTTCGGCATCCAGTGGCGACTCGGGGAAGCTTTGGAGGCGCGAATCGCGGCGTCTGAAGTTGCTGTCGGATCTCGCAGACCCA
GATCGATGCATGGAACGACCAGCGTGTCTTGCTGCAGTCGCCGTCTCCCCAGTTTGACTCGGACTATCGGCACTTATTTTGCTGTCACTACTTTGTCGGT
TCCACAGCTGATCTGCCAGCGACAGCTCAGGGCCTCGAGACCGGCCCGACGACTTGGAGTGACGAAGACTCGTAGGATTCACGGCCCCGCTCACTTGCTT
ACTGAACAAGTTCGTGCTGAGCAGACGACGAATCGACGATCGTCGCTGCGAAGGCCTCGGTCTCTGAGGCGTAATGTCGATCACTGATAACCGCGAGCGT
GGATGTAGCAAGACTGGCTTGCTTGGTGTCGCGTCAAACGGTTTGCTTTCAAATGGCAATGTGTCAGCGACGACGTCTTGGTCAGGGTCAGGTGCGGGGG
AAGCTACCTCCCTTGGCAAAAACTTATCATTCCCCGTCACAACACTGCCGTTTATGTCTTTTGCACTGCTACTCCTCTTGGTCTTCACACTTCCTGAAGC
TGACGTAGCGACATCAAGTGAGGTTTTGCCGCGGGCCAGCCGTTTACTAGGTGGAAGTGAGCGTGGCACAGTAATTGCAGCATTGCGGGCAGTAGGAGGA
AAAACACTTGCTGTCATCGCACTATAGCTTGGTACATCTATCGCCGCAGTAGGAAGTTGATCAAACCGTTCCTTCACCGACTTGAGGTCATCTTCCATTC
TGGCGATGGCTCCTGTTAAAACACGCACCATTTCCAATAGCTCGTCACGACTACTGTTGTCGTATTTCTCCCCAACAGGGGCAGAGATTTGAATCGCACT
ACGCGCTTCTGTCGCTCGCGTATTGCCCGGGTTTATTCCTTGAACGGGTGGCAACTGCTGCTCCAAGGGCTTATCCGAGCCCTGTAAACCGAACGTGATC
GTTTTGTCATGCAGCTCGACATCCATTCGATCTACGAGCGCTTGAGCTGCTTCAGCTGGAGTGATTGCCGTGTGTATATTATTCACGGTGGCTCCAAGGT
CGCCTCTTCGCTGTCGTTGGTCCAGCACGACGTCGCTGATCTCGTCCCACGAAAAGGGAAACTGCCCCTTTTCGATGCTGTCGTGAAACAAATGCGTGAG
AACAGTGCGTCGGTCTTTCGGGTAGCGCGAAATCAGACGCTGGAACGTGGCTCGGTCTAGAATGCACATTTCCACGTACGTGACGGCCCGAATACTTCCA
GCCTGCATGTGGTTCATGATCAAACCCATTTCTCCCGTGGTCTCTCCGGGATACATGAGCTGAGTCTCGCAATTTTCAGCATTTTCCACCGATCGGTCCG
TCGTCATTGATGTTGACGGCTTAAGGGCGCCTCCGGGCAGTCGGTACTGCTGTGGACGAACCTGCGAGCTCGAATCTTCCGCAGAAGTTGACTTGGAATC
GGATTGGAGTTTGAACTTTGCGCTTCCTCGCACCTGGTTGTTGAACGCCAAACGAGAGGACTCGGGTCCAGTGAACCGTGTGGAGCCGGTTGAACTACCA
GAGTCGGTCTCTTCGTCCTCTTCCTCGCTCTCACTTTCAGAGTCCCAGGTATACGAAAGCGCACAAATTCCACGGTTAATCATGAACATCTCGTCGCAAG
TCTCGCCCTTGCGTACGACATAGTCGTCAGGTAAATAAACTCGCACAGCCAAGTTCAGAATTATCTGCGTAGCGAAATCCGGCGAGCAGTCTTTCCAGAA
CGGAATCTCCGTGACCAGGTTCATGTACTTGTAGAGACCCACCTCCAGACCAAGAGTGTGCGTAAGTTCCCGCTGAAACTTGACGATGTCGCCGTCTAGA
CACTCGTACTCGGTCCACACGTGAGTGTAATACTGGTGGATTCGGTCGCGCAACTTGTCCGGGAGGTGCATTTTGTCCATTGTGGCGAACACCGCCTCCA
TCTTTCGGTGGTAGTTTGTAGTACTGGCATTGAAATTCGACACAAGCATGGCCACGTTGCCGAACACGATGGCGAGTATGACCGATCCGACCAGGATCGC
CACCGTGGAGAACAGATTCTCGTCAGTCGAGCCCACGACATTTCCTTGTCCTTGAATGAGGCTCACCGCATAGTAGTAATCTGCAACGTATTTTTCAATA
ATAGGCCTTGACTGCGACGCATGGCTTTCAGACACAATATGCCAAAGGCAAGCCATGTAGTGAGCAATTAGCAGCACCAGCCACATGAGCTGTGCGATTC
CTAGCAAATGCGAGAATCGAGAGTACCGGAGCCACGCCACCATGGCCTTGCTGATTCGCACCACGCGACTCAGCAGAACAGCACGCTCGATGAGTGTGAC
GCGCAGTACACGAAGAACCATCAACGCAGTCTCAGACTGAGTAATCAAGGGCGTATTCTCTTCCAGCGAGCCCGTGATGAGATACTGCAATCCGCAGCGC
GGTGTCGCCGACAGGAAGTCGATAATAAACCACTTGTTCAAATAGTTGCGGGCGATAAGTTTCCGTGAAGTGACCAGCGTGTTCTGGTCTTGGTAGGCAG
TGTTGAAATTGAGCAGGAGGTTCAACAGGAACATCAGCTCCATAGCGACGTTAACAGCTCTGATGCCTGCTGACCCGTCTGGGTAGTAGGCCGGTCCGAA
CGGCAAGTAGAAGAGTTGGAAGTGGTAGGTAAAAAACATGACGATGCCGTGCACTGTGGCGATTCGACTGGTGGGGGTGATCGGTGACCCAAGCGAGTGG
AAAAACTTTCTCCACGTCTTCCACCTGGTGAGTGAACGTATCATCCGCTGCAGCGAGAACCGGACCGATTCGTGTCTCGGTTTCTTCTTGACGCCCCCGT
TTTCCTTGTCAATCACGAGATTCTCGGCCTCGAACTTGGACGACGCCAATCCCATGTCCGACACTTTGCGCAGCTGGAAGCGCTGCATCATGGCCTCGTA
GTTGGCCGTCTTGACCTGCATCTCGTAAATGTGCCGTGTGGACATGCCTGTGTTGCGGATCGTGGCCCCCAAACTGCTCTTGCGCATCTGCGGTCGCTTA
TTAATCGGCGGTCGTTCTTCCATGGCGACGCTGCTGCTCTTGCTGTCTGCAGGAGGGAATAGGACTGCGCGCTGACTAACTTGGTCAAAATCGCTGGGAT
CGAGTTTTACGCGACACCAAGGACCGAGAATAGCTGCGTTTGTCAGTCGGTTCTTGATGTTAGTGCGAGTGGCAACGTCTGCGCTTGACGTCGACTCACG
CTTTGGTGAACTGAATGGTAAATGGCGCGAGGGATGGCGCACATTTCGTTGCTGCCAAAATTGGCTGCGAGTTGCGGCGCAACGTACGATTTCGGTACTA
TTATTGCTGGCACGAACAGCATATGAGGTGTCTCCAAGCATGACCCAGACAGCTCCACGTTGAAGCCATTTCTCGGGGTGTGGTGCCGATCCTGCAGTCT
TGATGGCGTCGACTAGCGGGGTTGAAGCCGTTGGCCCGTCTCAACTCGCTCGCAAATGATAGGCAGCCTCTCACTGCCGTCTACGCGCCGCACACAAGTC
GCCGAAGAATGAGCTGCTGCCCCGTGAACATGGAGCCCGCGAGGGCCACCGCCCCCGCCTCGGGCGCGATCAAGACCTTCCGCCAGACTAAGCTCTTTGT
GACAGGCCCCGCCAAGGCCAAGGCCGGCGTGCTGTCGCTCCCGGACATTTTCGGCATCGACAGCGGCCGCGTCCAGCAAGACGCCGAGGCGCTAGGCAAG
CTGGGCTACGCGGTGGTGGTCGTGGACGCCGCCGACGGGGACTACAAGACGCCCGACAACAAGGGCGACATGGCCGCGTGGCTCAACAAGTACAGCTTCG
ACAACTTCGCGGGCGCGCGCATCGCCGACGCCATCGCGTACCTGCAGCAGGAGGCCGGCGTGGAGACCATCAGCAGCTACGGCTACTGCTGGGGCGGCTA
CCTGGGCGCGGCCCAGAGCGCGAGCGCCAACCCGATGATCAAGGGCCACGTGTCCTTCCACCCGAGCTGGGCGGCGGAGAACAGGATTCACGGCCCCGGG
TCGGTGGAGAAGCTGGCGGAGCGCATTACGGTGCCGCAGCTGCTGCTGTCGGCCGGCAACGACCCGGACTTCGTGCGTGAGGGCGGCAGCGTGGAGAAGA
TCCTCAAGGCCAAGGCCGACGTCGGCAAGCTCAGCGATGTCGTGGACTTCCCCGACGTTATCCACGGCTGGGTGAACCGCGGGGACCTCGAGGACCCGAC
CACCAAGGCCGCTGTGATGAAGGCGTGGCACGCTGCTGTCAAGTTCACGCAGACTGTTAACCCTCTGTAAGGAATGGACGTGTCGTCGAGATAGTGTGAC
TGTGTAGGACGGGCGCTAAGACTTCGTTAACAAGTTGTCATTCAGTTTGAGCCAGCAGCATCGTCCACACGATGGCGTCAGTTGCAGAGCCTTCACCTCC
ATCGTGACAGGATCCAGCGCTCCCTTTGGCAAAGCCCACAACTGTCATCTCATCGGAGAAGAAAGGCTTCGTGCCGGTCTTGGGGTCCACTCCACTCATC
CACCACTCGATCGCGTGCCTCACAGAGCTGTCCAGCGGCGCAGCAACCGACACGGCGTGCACTTGGCCCGTGACGCCCCTCGACGGCACAGAAGCTGGCG
GCACGGGGAAGAACTCGTACCCGTCACCTTGGTTCATGCTACCGGTGAGCGGCACATCTCGGCAGGTGATGGACAGCTCTTTGGCCAGCAGGATCAGTCT
CGCGTCCAGCGCGAGTCTGGTCTTCCCACGCTTGCTGCGGAACGAGTTGAGCACCCGCAACGCCGTCTCCGCCTCCTCGTCCGTCATGCCGTCGTACGCG
TCTTCGTCCTCTGTGAGGCTCAGCCCCAAGTCGAAGGCCTGCGCTTCATCTGGAACGAACCTGGTCGGCAAGAAGCCGCACAGGTGAACAGCGTGGGGCT
GCACAGCGTTAGTGGCCCCCTGCTTGAGCTGGCACGTGCCGTCGCCCTCCGGCGCCCACGTCCAGTGCGTGCAGTCGGTCTCTGCGAGGCACAAGTCGGC
GCAGCGAGAGCTGGGCTCAGCCTCCAGCGACACCAGATCCAGCCCCTCGAAGTGGCACTCGTAGTCCCATTGCGCACGTCCGTCGTTGCCGCGCAGCCAC
GCGCGCGCGGAGCTGAAGGCGGTGAGTAGCAGCAAGAGATGCAGCAAGCCCATGAAAGTATCTAAGGGGGCTTCTGTCACTTTGCATCTGTAATAGAGAT
GTATTGCTGTCACCAAACGTCACTCGTGGGGTCAAAGGGGTAATGCATCTCATTTCAAAGCTGACAGCGTCGAGGAGAGATGGTAAATTGCTTGGTCCGA
AGGAAGAACACTGTTCGCTACCATCATTGACGAGGGCATGCCGGTGGGGATATCTTGAAGAACAAGATCAAATTGAAGTTTTTCCACGTCACGTGCGCCG
CGTTCGATCGCCAGCTCTTCTTGTCGAAGAATGGCTGCGTGCGACTGTGGTGCTCAATGACCACGGGCGGCCGGTAGGGTTCGTGGAGATGCAGCCATTG
CTGTGGCTCAAGAACCCCACGTGCTTCGGAGAGAACTTTCAACCGGCCGAGGGGCACATTCGTGTGCTAGTGAACATGCCAAAGCCGCGAAAGGAATTGT
GGCTCGTCACGGGATCCGTCGAAAACGCGTTCAACACGATAGGAATTCCTTCTACACTGTACCATCTCGCAGCGATACATATTGGCTACTACGATCCCGC
T