Description :
From Genome Similarity Track
Location :
contig_47:374290- 375356
Transcript NameFunction/comments
g9714.t1hypothetical protein

Sequence
1066 bases(100 bases per row)
ACTCAGATGGTTCAGAACCTCTTCCGCAAGATCTTTCTTGAAGGCGCCTTGAAACAGGTCATAGCGCAGAATATCTTCCGGTGCTACTTTAAACATTGAC
TGTTGATCATTGAACATGGTTAGATAACACTTCTAGTATGCAGCGTTTCGACAACATGGAACGCACCTGCATGATTTCACCCAGCTCTTCACACCTCTCA
ACAGCGCTGTCCTCTTCCTGGAAGCGGAACGAAATATCGGCCAGCGCTGCAAGCTCATCAAACACCCACTCCGGACAGCCGTTTACTCGAAGCATGTGCA
GATATTCGAAGACTGCGTGGACGATTTCCTCCCAGTGGGAAATACCCTCCAATGTGAGCTTCATGGTAATATCAAACTTTGCAGCGTAGGTACCGCTATC
GTAGCCGTCCGTGTCTGTCACTCCAGCAGTCACTGCAGAAATCCACCCGCGCTCCTTCAGCTGGAATACACGCCGCAATTTAATAATGAATATCGCCCCC
GATTTCATGAGGGAAGAACGTAGACTGACGTACATGTGACAGCACAGATCCTTCACTCTCATGGCCCAGCAGACTAGCGATATAGTCCGCGGGTTTCTGA
TGGTGCTGGCCAAGAACCGGTGGGATCATCCAGTCCAGATGCAGGGTATGAATATCCCGAACCGGCACAATCTTGCAGAGGAAAGATGAGCCAGAACCCT
TCGCTCCAAAAGGCGAACCTGCCGACGCAAAAGACGGCACCGTGACCTGCTTGTGCGGGATCGCACTGAACGAGTTTCACCCACTGCTCGAGTTCATCCA
GAGCGTTTTCACCGCATACAACGAGCTTCATGATGTTCGCTGAGTAGTACTTTTCATAAAACTGCAAGATTTGCTCGCGGACGTCCACGCCCGTCTTCTC
CGGCAGCTCCAGCAGACTCTTCTTGTTTCCCCAACTAAATCGGTGATATGGGTGGCTAGCGGGCGACACGTCACACAACACTTGCTGCAGCAGAGACACA
GCAAAGCCCATCAGCACAAACTACCTCTCTCCTCACTGCCAAATTCCTCTCACCTGAGACCGAATA