Description :
From Genome Similarity Track
Location :
Scaffold_90:374272- 379567
Sequence
5295 bases(100 bases per row)
CTGGAAAGTTGCCGCGTCGCTCGAGGACGAATCAGCGTCCGGGATCTCGGACGGATGGTACTTCTTTAAACATCTGACGTTCTACGTCGGATGTAGCCGT
AGTGTTGAAGGAATGTCGAGCGTATAGGCGTCACCAATAACCTTGGTTACCGTAAACGGTCCAATAAAGCGCGGCGCGAGTTTGTTCGCGCCGAGGTTGG
TGACCGCTGAGTTTCTGATACCTTCAGTCGACAGGAACACTCGTTCGCCTGTCGTAAATGTGGCCGTTTTCTTGCGGCCATTCTTGTCAGCGTTCTCCTT
CCGCTTGTCCACTGCGTCCTGCAGTGCGTCTCGAACATAGCGGGTGACCGTTTGGCGCTGTAGTACAAAGTCGGAGACGACTGCGGAGTCGATTGGTCGC
GCCGCATGCGTCGGCGCGTAGTTAGCCGGCGCAAGTGGGCTCGGTGCGGAACGTGTCACTGCGTTGACCGACGTGGAAACTGGGGATACACTCGAGATAT
CATTAGCAACCGGTGTATGTACCGATTGACCCAGTACCGGTGTTAAGGGTGGGGAAACAGAGCTGGAGGAGATGACTTGTCGGGAGCTTCTTTCCCACCC
AGAGTGGAGACACACGGCGCTGTGAGATGGCCCACGGCGAGGAGAGCAGAGACACGTGGGTGTCGCACGTTCTTAATGAAGAAGGGCGTCAGCCCAGTCG
ACGCGTGTACCGCGTTGTTCAGCGCGAACTCGGCCAGAGGCAAAAACGAGCTCCAGCTGGAGAACGACGTCGCTTAGCTTCGAAGGACGTCTTCGAGGAC
GCGATTTACGCGCTCCGTCTGGCTGTCCGTTTCCGGATGAGCTGCCGTGGACATCAACAGCTTCAAAACCAGTAGCTCTAAGAGCTTTGATCAGAAGGCC
GACGTGAAGCGCGGGTCGCGGTCGGAGACGATAGATTCAGGAAGGCCATGATGGCGGAGGACTGTATCGATGAAGTGCACCGCGGTATCTGCCGCGGTGA
TCGAATCCGACACCGGAATCAGGTAGTCCATCTTGCTGAAGCGGTCTACGAACACCAAGACACCTGAACGTCCTTTTGCGTCGGGTGGGAGCCTGAAGAT
GAAGTCCATCGACACCGAGCGTCAGGTCTCGATGACCACTGGTGGATGACGCAAGGGGGCCTGCGAAGACGAGGCAGATTTCACGCGCTGGCAGATCTCG
CAGGTGCGCACCCACTTACGCACCCATTTATACAGGTGGGGCCAACAAAAGTCGCGTGACACAGCGGCAAACATCTTCTCGCGACCGAGATGAGCGCCTA
GCGGGGCATCATGAGACTCATGGTTAATCCGTGAGCGCAGATCGGGGTCGTTAGGGACAACGACACGTCAGCAGCTCGTCATACGTCAGCAGCTCGTCCT
CGAGACGATATCGGTGGATTTTGTTTCGTACAGAGCGGGAAAGGGCTCCCAGTGTGTCGGCGCTGGGAGAGCGGAGATGCTCCAGGATACTGGAGTACAT
TGCGTCATGCTCGTAAGCAGCTCGGACCTCGTCGCGAAGTGGCGTTACCGGGGAGACGCTCGTCAGGTTGACTCCTGACACCTCTCTCGTGGCACACTCG
TCTACATCGTCTTCATCGAGCGAAGCTTGTCGGCCCAATACACCGCGTGGGTCGTAGTCGGGACGCCTATACAAAACGTCGGTGAGAATGTTGTTCTTGC
CGGGCTTGTAATGGACCACGAAGTTGTACTCGGAGAAGAATGAAAGCCAGCGGGCCATCCGCTGGGATAGATGAGGGTTCTTCATCGCTTTCCTCAGCGA
TGCATGGTCGGTGTACACCGCGAAGGTATCCTCGTACAACAAGTACACTCTGAACTTGATCAGAGCGTAGCGCATCGCAAGGAGCTCCTTGTCGTGAACA
GGGTAGTTGCGCTCCGCCGGCTTCATCTGTTTGGACTGGTAGCTTACGACGCGCTCTCGACCTTCATCATTGAATTGTATCAGCGCACAGCCGATGGCGA
AATCGCTTGCGTCGCAGACGACGTGAAAAGGTTTCGAGTCATCCGGGAGCGCGAGGATTGGGGCCTCGGCGAGATGCTTCTTCACCGAGTCGAAGGCGAC
TTGATGCGCGAAAGTCCACGACCACGACACATCTTTCTTCAACAACGAAGAAAGCGGCTGAATCAATCCGGCGTAATTCTTCGTGTACTTGTGGAGATAA
TTTGCGACACCCAGCCACTGACGCAATTCAGTGGGATTCTGTGGCGTAGGCCATGCACATATCGACGACACTTTCTCGGGGTCGGCGCGGACGCCGTTCT
GCTCACAAAGCAGCCAAGCACCGGACTCTCCGGCGCACAGAGTATGCACTTCTTCAAGCTGGCATACAGCTTGTTTTCGCGCATCACTTGCTTCAAGTGG
ACCTTAAGCGCGCTGAGGCCTCCCTCAGCGCGACTGTGTACGAAGATGTCGTCAAAGTTACTCGGTGCGAAATCGCGGAGCGGGCGCAGCGCATAGGATA
CCATGCGATTGAACGCGGCGGCGGCATTCTTCAAGCCTTGTGGCATAACAAGCCACTCCCAGAGCATACCACTGGGCGTGCTTACCGCTGTGAGCGGTAT
GTCGCTCAGCCTTATGAGGATTTGGTAGAACCCATCGGTCAAGTTGATGGCGCTGAAGACCTCACTACCCGACATTGCGTCGAGCATCATGTCTTTCCGA
GGAATCGTCGTTTGGGCAGGAATGGTAGCGTCGTTCAGCTTGTTGAAGGCATGGACGATGCGCCACCCACCCGTGGCTTTCTTCACACAGAAGGTCGGAC
TGGAGTGCGGCGATGTGCTCTCCCGCACATGACCCGCCTTGCGGCGGCTCTCGAAGAAGTCATCGATAGCTTGGACCTGATCTCGCGGGAGCGGCCACTG
CCGCGTCACACAATACTTCGAGCTGGGCACGAGATCGATCTCGTGGCGAATTCCTCGGTCAGCTGGTAGCTCAGCTGGGATCTTATCCGGAAAGCCATCT
TTATATTCGCGGGCGGACTCGAAGACAGGATTGCCGGATTCGCAAAGCGCTTCCCAAGATTGCGCTGCGAAGCACTCCTCGCGGGCCGACTTCGGCTCGG
CGCTCTTTGGGCGCGAGGGAGCGTCGTCGTCACTGACTGCATTCACTTCGAGCGACGCCGAATCGGCGTCGGTGGTCAGGCAGACCTGTTCGATTTCATC
GTTCTTGAGGCCGCGAAGGAAGTTCTTCCAGGAGAGGCCTGGAAGTCGAGTGATCGACTGCGCCTATCGAGGTGGGTTTGCAAGCTCGAGCGTTCGTCGG
CGACCGGAGGTACTTTCCACATACTCAAGCACGCAGACCGACTCCGTCGGTGAGCTGTCACTTGGTACGGGCTCTCGGCGAGGTTTCAGCCGACGCCGCT
TCGACTTCCTTTTTCGCCGCCTCGAGTGCAAACTCGAAGATGATGAGTCGCTCTCGCTGGACGAGATGTCACCCCCCTCTAGCGGAAGCCTCTGCTCGAC
CGCGGTAGTGTTCAGCGGGAGCGCCAACTGCTCGACCACCGGCTCAATTGACGGGAGCCCCTGCTTGACCGCCAGTTGGTCTTCATCCCCGCGTCGCCGC
GGGGATTCGTCAGCTAACAGCACTGCACAAGCCGTACAGAGAGGACCATCGCTCACTCTGTGCGCAACGTGCGTCGTGGATGACCGGTCATCCACGACGG
TAGCGTGAGGCCAATCTTTATGGGCGACCACGAGGTGCGTGAACAGCTCCCTCACGTCATAACCACTGCGACGCTTGACCGACCGGGCCAACCAGTCAAT
ATCTGGTTGATAGCGCGTCAACCACGGCATACCCAGGATGCAGTCAAACGCGTAATTCATCTCAATGACGAGAAAGTCGTCGTTGCTTCGGAAACCGTCG
AACGTGTACGGAAGTGTAATCTCGCGCAGCGCAACGCGGCGTAATTTCCCATCGGCCAACTTGACAGCGTACCTTTGCGGACAGTGATGTCCGACGGGAG
TACCGACAAGCACGACGCGCGGATGTTGGTCGCTCCTGAATCAAGGAGCGCTTGCAGTGGTCGCCGGGCGCCGGCGACATGAAGACTGACAATGATCAAT
CTTGAATCGCTCGGTGTGGTGGTGACATGAAAGTGTGCATGTAGCACAGGACCGCTAGGAGATTAGGTTGTCACCAGGGAACCCGGACCTTCATTCCAGC
CAGTAGGGCGCTCCGCACCTACTGACCCTGACCGTTTTTTGGCTGGTCAGAACTCACGGGCTCGGCATCGACATGCGAAAGCACTGGAGCTGGCGCGCGG
CACTCCTGCCGCGCGATGACCGACCTTCCGGCAACGGAAGCAGGTGAGAGAACGACCGTTCCAAGCACCGCTTCGACGCGCTACATGACGCTGACGATTG
CTCGTCGCATCGATAGCGTCGATGTCCATGGGCTCGGGTGCAGATTCTCGAGCTGAAGCGGGCAGCGCGTGAGCGTATGACGCCGCAACCACGTAGTCCT
CGCGTAGTGCAGTAGTGCAAGGGCAAATGCCTCTTCGAGTGTAAAGAGATCCGATCTGGTAAGGCAGTAGCGCGTCATGCCTTCGCGCATACCGAACACG
AGCACATGAGCCCGAGAGGCCATATCGATGGCCTTGGCCATGATACACGACGCGAGGTGTCGCGTCTTCTGGACGTAGTCGCGCATAGTCATCGTGTCTT
GCCGAAGGGCGAAGAAGTCTGCCCGAATTCGGTATTCATCTTGCAGCGGCTCGAACGCGAGCCGAAGGTCACTTTGGAGGGTATCCAGAGTGGGGAAGGC
GTTGGGGTCGACGACCCAACTTGCCGAGGGCCCATTCCTTGGCTTTCCCAGACAGCCGCGAGAGAAGGAAGTGGGCCTTCGCGGAAGGCGCCTCGATCAA
CCTCGAGGCGATGTAGATCTCTCGAAACCAGCGATTCAGCGGAAGTCGGTCTTCTCCGGCACCGGAGTAGGTGGACGTCTCTAGCTTCACGACGTCATCC
GTGAAGATACGCGAGGGAGTTGACACTCACCGATTCGCATCGGCGAGCTCGCATTTCATGAATTCTTGTGTCGCAACGCGCTGCTCGTTGGGCGTCGCTG
AGCGCAGCAGCGACGTGACGACGGCTTCTCTGGACACCGCCGCGAGGCGGTGGAGAGCTTTCCACTCGATCCGAGTGAGATGGGGGAAAGCCGCGTGGTC
GAGGACATGGCTCATGTCGAACTTTGTCATTGGAAGGACTACTAAGTGCTACCAGGTGTAACCGACCAGGTATTTACTCCGTTACTTGCTTGCAC