Description :
From Genome Similarity Track
Location :
Scaffold_3:374259- 381377
Transcript NameFunction/comments
Physo_127888reverse transcriptase

Sequence
7118 bases(100 bases per row)
ATCAAGCGGCGGTATCCACGACGATGCTGTTGCGGAGGAGCAGCACTTTGATCCGTTAACGAATCAAAGGCGCGACTACTACATCGGGCTCTTCCACGAG
CTCCGGTACTTCTCCAGCAAGAAGACCTCTTCTCGCAGCAAAGTGCCTGAGTGGCAGGCACTTTGTCAAAGTTGGAATGCTTTTGTTGAGAACTTCAACA
AGAAACCGGCTGCTTACCGCGAGCCGGTTAAGCATGCCCGTGAGAGCTTCGAGACATTCTCGACGCGCGGGCGGCTGGAGCAGCTCCACAGATCCTCTGT
GGACGCTGGTATTCTGTGCGCTGTGCCCGAAGGCCAACAGTGCACGTTGTGTCTTCCGGGTGCGGCGCGCTTGAGCGACCGCGACCTAAACGGGTACACG
ACGATTCGTGTACCTGCGAGTCTCAGGGATCTCCGTGCCAAGTTCCTGGCACGCGAGGAACGCGATGATCGCGAAACTCCGGGCGCTGCAGGTAATTACA
GCGCTCGCGCTACATTCACGCCGGTAGTCCGTGGTGAGCTTCGTACGCCCTCATCATTTCCGGAACGTCCTGCAACAGGACGTCCCGCGGTTCCCATGTA
TATTGGTGGGGTGGAAACCCTCGCCAACGAATACGATAACGAACCGGCTGTCGGTTCGTTTTCGGGATACTATGGTTCACAATACGCTCAACAATCCAGC
GTGTTGAGCCGTGGGCGTCGCGGATCGGAGGCGGCGGTGGTGGGAACACGCCCCGGGTATGGTCAACCTGGAGTTGACCTTGGCCCGACGCTCGAGGAGC
GGGTCGCTGCTGTGGAGCAGCTTCAGAGCCGTGAGGTCGCCGCTCTGAAGCAGGAGATGGCGACCCTGAGAGCTCAAGTTGCTCAGACCTCGCAGACCGC
GACGGACATCTCTGTCGACGTGGGAGGTCGCGTCGTGCGCTTGGCTCAGCGCGTTCACGCGCTGGAGCAGAGGTTCGCTCCCGCTGGGGCTTCCGCTTCG
GGCCAGCCGAGCTAGGTGGCTCGTGCTGCCGGTATCGTTTCAGCCGCCCGACGTATAAGGTCGGATGGAGGCGCATGCTAGATGGAATATCTAGCGTGTA
CGCGTTGTCATACCGTGCCAACACCGTGAACGGCCCGATGAAGCGCGGAGCGAGCTTGCTCGCCCCGAAGTCGGAAACGGCATGTTTAGGCAGGTTTTGA
GTTGCTAACAAAACCAATGAACCCTTCTTGAATTCATTAGTGTTGCCCCTACCAACATTGTCTGCGTTCAGCTTCTGTAGGTCGACAGAAGCTGCAATAG
CGTCTTGGACTAACCGAATGACGGCTTGTCTGCGCTGCACGAAATTGATTGCGTCCGAGCTGAACTCGTTCAGCTCGTTTCTAGCAGTAGGCCCGGCCTC
TGCGTTCGTCTTCGCGGTGTCTGTGCCCTGCACAGACCCGTTCTTCTTCTTTTAGCTCTTGTCGGCGTCTGTGCCCTGCACAGACGCGTGCTTCTTGTTC
TTCTTGCGCGTAGTACTGTCCAAGTGTCAGCGGCATTTTGCGGCTGCTGTGTTGCAGTCGTAGATCCTCCCCCACTTAAGGAAGGAGCCGCCATCCCGAG
TAGACTCGGGAGGTGTGGGTGCCTGATGGCATTCACGTAGAACGGTGTATGCCCGGTCGAGGCATGCACCGAGTTGTTGATGGCGAACTCCGCCATCGGC
AGGCACTCGCTCCAGTGTTGGAACGAGTGAGCGTAGCTCTTAAGCACGTCTACGAGCACGCGGTTCACGCGCTCGGTCTGCCCGTCCGTCTGCGGATGAT
CCGCAGTCGACATCGAAAGCTGACTCCCAAGAAGTGTAAACACTTCTTGCCAAAGGTGTGCAGTGAAGCGCGGGTCCCGATCCGACACAATGTCGATCGG
CATGCCATGGTGTTTGAACACTATGTCAACGAACAGACGCGCCGTCTGCTTCGCAGTCACTTCAGTGGGTACCGCAGCAAGATGTACCATCTTGCTGAAG
CGGCCAACAAAGACCACAACGCGCGTGTTCCCCTGGCTGTCCGGGGGAAGACCGAACACGAAGTCCAAAGACATGGACTGCCAAAACTCTCGTGGAGTTG
GTAGTGACTGCAAGGGAGCCTGCGCGAAAGGCGCAGGCTTCACACGTTGACAAACCTCGCAAGCACGGACGTACTTGCGCATCCATTTATACTGGTGGGC
CCAGTAGAAGTCTCGCGTGAGAAGAAGGTATGTCTTCTCACGGCCCGGATGCCCCGCAGTCGGTGCATCGTGATACTCGTACATGATCCTGAGTCGCAGG
TCATGGTCATTGGGCACGACAACGCGGTCCGCGTTGTCGTCAACTGCACTGTAGAGTAATAACCCGTCGTGCACCCAGTAACGGTGTGCACGAGCACGAA
GATGCTTCGGCAGCTTCTGACGAGCTTGGTCAGAAGGCGCTGAGCCGTAGGCCAGCAAGAGCTTCGCGTCCGCGTCGTGCGTGTACGCGACCTTCACGTC
GTCCAACAGTGACGACGTTGGGGTGCTCGATCGCATGGCATCAATGGCATTGGCGTCGGCATCAGTCGTGGCGTAGCCAGGTCGACGCGAGAGCGCGTCG
GCCACCACATTGAGTCTTCCGGGTTTGTACTCAACCCGGAAGTTATACTCTGCGAAGAATGAGAGCCATCTCGCCATCCGTTGCGAGATGTGCGGCGACT
TTACAGCCGTCCGCAGCGACGCGTGGTCCACATAGACCACGAACGGTTTGCTTCCGAGTAGATACACTCGGAACTTCGCAAGTGCGTACTTCATGGCAAG
GAGTTCCTTGTCATGTACCGGGTAGTTGCGCTCAACTGGCTTCAGCTGACGCGATTGGTAGTAGACGACACGATCACGGCCCTCGTGATCGTGCTGCATC
AACGCACATCCGATTGCGATGTCGGATGCGTCACACAACATGGAATGGGCGATCTTGGTCGGCCACCGCCAAGATCGGCGCCTTATTCAAGCCCCGCTTG
ACCGCATCGAAGGCCTGCTGACACTCAGCAGTCCAAATCCACTCGGCGTCCTTCTTCGAGAGCTGTGACAGCGGGTGTATCATGCCCGCGTAGTCCTTCA
CGTATACGTGGCCAAGCCAAGGAACTGCCGCAGTTCCTTGACGTTTGGCGGCGTCGGCCACTCATTGATCACTCTGACCTCTCAGGGTCAGGGCGGACGC
CCTTCTTCTCAACGAGACACCCAAGCACGGGTATCTCGCTCGCCCCGAAGATACACTTCTTCCGGTTTGCGTAGAGCTTGTGCTTGCGCATGAGCGCAAG
CAGCTATCGGAGATGCACCTTGTGCATCTCAACATCACTCATCCCGTCCGCAGCTCGGCTGTGGACGAACACATCGTCGAAGTAGCTCGGTGCGAAGTCG
CGCACCGAGCGCAACAAGTGCGTCACGCACCTGTTGAAGGTCGAAGGGGCGCTCTTCAGACCCTGCGGCATCACTAGCCACTCCCAGAGCATGCCGCTCG
GCGTGCTCACAGCCGTGAGAGGGATATTGCTCTCACGCATGAGGATCTGATAGAACCCATCGCGCAGATCAAGAGCACTGTAGATAGTGCTCCTGGCCAT
CGAATCGATGATTACATCTTTTCGCGGTATCGGTGTCTGCGCCGGTATCGTCGCATCGTTCAGCTTGTTATACGCATGAACGATGCGCCATCCGCCATGT
GGCTTCTTGACACAGAACTTCGGGGCACTGTGCGGGGACTTCTATCCCCACACCTGTCCAGCTTTGCGACGACTTGCAAAGAAGTCGTCGATCGCCTTGA
CCTGTTCTCGCGGCAGTGGCCACTGCCGCGTGACACAGTACTTCGTGTCCGGCACGAGATCAATCTCGTGCTGGATACCCTTGTCCTACGGAAGCTCCTC
AGGGATCTCTTCCGGAAGCACGTCCGCGTCCTTCCGTAGAATCCCGTAGAAGGGACTCGTCTTCAGCGAGTCCCAGCTCTGCTCCTCAGAGCGCTCCTTC
TTAGTCTTTGCACTGAGATTGACCTCAGTCTCAGTGGTGGTCTCCATGAAGAACTGCCTCAGTTCTTCATTCTCGCTCTTCGTTCTCTCGGCGTCCGAGA
GAATGCATATTTGCTCGATGCGTCCATCGTGCAAGTCACGCGCGAAGCGCTTCCAGCTCATGACTGGAAGCGAAATCAACTCCGACGCTTGCGTCGGAGG
ATTAGCGAGAGGCATCTCCCTGTACCTGAATCCGGCACAGGTACGCGTCAAGACGTTCAACGTCTCGACGTCCGGCTTCTCAGCCTCCGTCTACCCGGCA
GAGATTTCTTGTAGCGTCTCGGCCCCGTGCCGAGACTTGCGCAGTGACCTTCGCATGCGCCGTCTTCTTGTTTTGCGGAGCCTGGCTCCGCTTGGTTCTT
GACCTCGTCCAGGCCCAACCGTGGACGGGTGTTCTTCTATTATACCGCCGGCGGGTACATCCCGCGGGCGAACGACTTCAAGCCCAGCTTGGTCGCACGG
CGCTTAGTCGTGCAGCCCCGCTGCACGACAGCATGCAAGTTTTTCCGGTGCGAGACGTTTGCAACCGTCCGCACCACCTGCAGCGTCGGCTCCCGGAGCC
GCCACGCCATCCTCACCTCGACGCATGTTATTGGCGAAGCCCTTTATTTGAAGGGGTGCGTCGACTCCCGGAGTCGACGCGAAATTCTTTTTCGCAGCGA
CGGTTCCCGGAACCGTCGCGACTTTAATACCTCGACGCCAACCATTGGCGGAGACCCCCATTACGGAGGGTGCGTCGGCTCCCCGAGACGACAATCAAAT
CACCCAATCCATCGACTCCCGGAGTCGACGGCGTTACGTCACCTTGGCTCTTATTATTGGCAAAAACTGATCCAATCAGTTTTGCGTCAGCCTCCACGGC
TGAGGCGTGTGACTCGCCTGCGTCATCCGCGCCCTTCGAGGCCGGAGACTCTTCCTTATTCCCTGAAAAGCTGGTGTCGACCTCCGAGGTCAACACATTT
TCTTCATTAGCTGTCGGCGGTTACGCCGACGCTAGCTGCTCTTGCGCACGTGCTCGCGCGCGCCCAGGGCACTCCGGGACAGCGTCATTAGGCGCTGTCT
CGAGTGGGGAGTCGCGCGCACCTGTCGGTGCGTGCGTAGCGGCAACAGGGCCATCGCTCACTATTCCGCTGTCGCGACCGAAGCGCACGAGAGTGCGCTT
CTCCCAATCGATGACCGGATCATGCCGTGCAAGCCACGGCATGCCCAATACAATGTCAAACTTATCGTCCAGATCCAGGACGATAAAGGTCTCGACAAAC
TCTTGATCTTCATACGTGAAGCGCACGCGTACCATGCGCTTCTCGGTCTTCACGACGGCACCCGTTGCCAGTCGTACTTCCAACATACTTCGAGGTATCT
TTAAATCCTCGAAGTCAAGCCTTGATAGACTTCGCAGTCGAACAAAGTTCTTCGACGAGCCAGAATCTACCAAAGCACGGAGAGAGCTGCTTGCTCTCAT
CGAGTTCACGTTCAGGATGACAAGGTCAGGCTTGTCATCTTGGTTCTTGCAGTGAGAATGAACCTCACTGGGGGCTGCAGTCCTCAATGTCGCGTGTCCA
AGGTCGACACGCGGAACGCATTACCAGTAGGGCGCCCCGCGCCTACTGGTGTCCAGCGTTTTTGTTTGGTTGCGACGGTGCCCGGCACCGCCGCGATAGC
CACCCTGCTGGTGCACGGGGGCCGTGCACTCCCGAGCAAAGTGACCGACTCTACCGCAACGGTAGCATCGCACATTGTTTCCCTGCGAGTGCTGGGGTCC
AGCAGTTGCAGCACTCGAGAGGTCCATGGGTTCTGGGCCTCCCGTCCTCACTACCGGGCGTGGCTGTGGCCTCGTCACATGTGCATGTAGTTTAGCCTGC
CGCAGGCTAAACTCCTCCTGCATTGCAAGAGTAATTGCAGCTTCGAGAGTACTCGGGTACTCACGGAAGAGGTAGGTCTTCACAGGCCCATCTCTCAGTC
CCTGCATGAACGTGACGACCTTGGTCGCCTCGTCGATCGGATTGGTCACGATGTTCGAGACCAAGTACCGCGCTCTCTGAGCGTAAGCATGGACATCATG
CTTGCCCTGCTGCAGGTCGAGGAACTCCGCCCTCGACCGGAACTCGTTTTGCGGTGGCTCAAACGCTTGTCTGAGCTCTTCCTTGAAACCCTCGTACGTG
CTAAAGCACGTAGGATCCGAGAGTCGGCGTCCATACGCCCAACTTCTTGCACGTCCGCCAAGACATGACATGGCGAACGCAACCTTCGACATCGGTTCGA
CGATACGTCGAGCCGCAATGGCAGTGTCGAGTTCGACAAACCAACGGAGGAGAGGTTCACCCTCTCTTCCGACATAGTTGCTCACATTGAGCATCAGCGA
TTGCGCGCGTGGTGTCGTCCCGGATGACACCGCGGTAGTAGCAGCAACATTGCGTTGCTCCTTCAGGGTGAAACCCAGAGCAACACCGTGTTGCTCTGTC
GGCGTTAGCGTACGCAGCATCGTAGCTACAATCGCCTCACCAATGACTGTTGACAGTCGTTGGAGGGCCTCCCACTCTGGACCCGACAGGTGGGGACAGT
CAGCGCGTGCAACGTGAGTTGCATGCGTAGTGGAGCTTTCCATGGGCACCTCTGTATCCATGGGAAGGTTCTCAGCTCCGCGTTCGTGCGGTGACGTACG
AACTCAGGTAGTCGGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAGTGGGCCTACTTTGGCTCACTACTTTAGCTTACACGTGTGCGCGTGTATGT
GAGGAAGCGTAGCTTAGTTTAAATCAGAGTTAATTATACTCGGGCCTCCGAGTATAGATTAATCTAAATAAACGATCCAAATAATGTTTTTGGGGAAAAT
GAGAACTGCTATTTTTGTTTTATGTTTCTGACTTCCTCTAAATGTAATAATCTAAACTAGGAATCTGCCAACGGCTGGTTGGCAGAATTCCAATGCTATG
CATGTCTCTCATTGGTTAAAAGATGCCGCTCTCAACCAATAGGAATCCTAAATGTGTATGGACCACCCGTCGTGGTGGTCGTAAATGTATGTAGCCTTCG
GTATGTCTACACCAAGGT