Description :
From Genome Similarity Track
Location :
contig_47:374240- 375306
Transcript NameFunction/comments
g9261.t1hypothetical protein

Sequence
1066 bases(100 bases per row)
AGGAGAGTCGGCGAATGTCTGTGAAACGATCGACAGACAAACGGTCTCGGCACTCAGATGGTTCAGAACCTCTTCCGCAAGATCTTTCTTGAAGGCGCCT
TGAAACAGGTCATAGCGCAGAATATCTTCCGGTGCTACTTTAAACATTGACTGTTGATCATTGAACATGGTTAGATAACACTTCTAGTATGCAGCGTTTC
GACAACATGGAACGCACCTGCATGATTTCACCCAGCTCTTCACACCTCTCAACAGCGCTGTCCTCTTCCTGGAAGCGGAACGAAATATCGGCCAGCGCTG
CAAGCTCATCAAACACCCACTCCGGACAGCCGTTTACTCGAAGCATGTGCAGATATTCGAAGACTGCGTGGACGATTTCCTCCCAGTGGGAAATACCCTC
CAATGTGAGCTTCATGGTAATATCAAACTTTGCAGCGTAGGTACCGCTATCGTAGCCGTCCGTGTCTGTCACTCCAGCAGTCACTGCAGAAATCCACCCG
CGCTCCTTCAGCTGGAATACACGCCGCAATTTAATAATGAATATCGCCCCCGATTTCATGAGGGAAGAACGTAGACTGACGTACATGTGACAGCACAGAT
CCTTCACTCTCATGGCCCAGCAGACTAGCGATATAGTCCGCGGGTTTCTGATGGTGCTGGCCAAGAACCGGTGGGATCATCCAGTCCAGATGCAGGGTAT
GAATATCCCGAACCGGCACAATCTTGCAGAGGAAAGATGAGCCAGAACCCTTCGCTCCAAAAGGCGAACCTGCCGACGCAAAAGACGGCACCGTGACCTG
CTTGTGCGGGATCGCACTGAACGAGTTTCACCCACTGCTCGAGTTCATCCAGAGCGTTTTCACCGCATACAACGAGCTTCATGATGTTCGCTGAGTAGTA
CTTTTCATAAAACTGCAAGATTTGCTCGCGGACGTCCACGCCCGTCTTCTCCGGCAGCTCCAGCAGACTCTTCTTGTTTCCCCAACTAAATCGGTGATAT
GGGTGGCTAGCGGGCGACACGTCACACAACACTTGCTGCAGCAGAGACACAGCAAAGCCCATCAGC