Description :
From Genome Similarity Track
Location :
Scaffold_57:374230- 377561
Sequence
3331 bases(100 bases per row)
AGTCCGTCATTTCCAGATCTGTCCCACTACGCTCAAAGGCGTTGGTCGTACCATCGTCAACATCATCCTCTTGCTCGTCTTCGATCGCGGCGATAGCCAA
GTAGTGTTGTCTTAGAGTTTCAGTTGGGTCTCTCGTCGAGTTGCATTCATCATCTTTAACTTGTCCTAAGCCGTAGTCAACTCCGCCGGGGTCGAGCACC
GCCGCCGCTGAGTTCGTTACTCCGACCTCAGCGATAGTATCTTCCAACAGTGACACCTCTGGTAAATCATAGTTGTCGTCTGCGTCAGGGCTCGTATTCG
CTGAGCTCGCTGCAATGGTCGATCTGACTCCTGCGTGTTCAAACTTGGCTCCGAGGTAGATGGTATCATCGTCATGCTGTATAACCACTTCCGACCCGGT
TGCAGCATCTATGGTCTCCAACGCTGAGTCCGCCGTAGCTGGGTCGTCGTTCGGCTTTATTCCTTCAGGTAGTGATACCTCCCGTCTATCATAGTCCTTG
GTCGCGTCGGAGTTATCATCCGCTGAGTTGGTTGTGACGGCAAAACTAACTTCCGTGCGTGCAAACGCGTCTTCGGTATAGCCGACGTCCTGACGACATG
TTGGGACCGCGTCCGAAACGCTCTCAGTGTATAGATCTTCTGACGCCGAGTCCACCGCCGCTGACTGGATAATGCAGGCTTTTGGTGTACCCATCGCTGA
GTTCACCACGGCTGCAGAACTTAACCCATCGACTCCAGACTCGGCTCGTACCTCACCTTCATCACTGTTGCTACTGGTATTCACCGTCCAGCTCAGGCCT
TCACTGTTTCTCAACAGTTCTGGAAAGTAATACCTCCAGCTTGGAATTTGCAGTCGTCACGCTAGGGCGCTGTACCGCTGAGTCTGCTACGACGGCAGGG
TAGACATCCACGCGTCCACACTCGTCCCTCCCGTAGTCGGTTGTTTCATAGCACACCGGAACAGCTCCCAAGTCATTTCTTGCGGCTGGTTTTCCGTTCG
CCGAGTTCGCCGTCACCACATGGGTAATCCCAGCACTTATAGTGGTCAGTGTGCTCACAGCTGAGTTCACTTTGCCCACAATACTGGTCTAATGAATCCA
AACTTGGCTCGGTTGTCAACAACGGGTTGAGCGTCACGTAGGGCGTGTTCCGAGCGTTCTTCAGGGTCTCCTTCCGTTATAGCTGAGTCTTCAGTCGCCG
ACACGTCTTCCTTGGCCCTTACTGCACTTGTTCCTTCAACCGCTGAGTTCGTGTTGACGTCAGAAATGGCGCCATCGTCCTCAAACTTGGACAGCTGATA
GGAGACATCTTGGCCATCGTGTAGCACCGGCGTACGATTTGCTCGGACGTCTTCCAGCTTGAACGCTGAGTTTATAGCCGGGTCACCCCTTGTCACCCCT
GAAGTCGATATAACGTCGGCGTTACCGCGACACCTCCCGTCTTCGTCGGCTTCTGTATCTGCTTCGATCCTTTTCCAGCGTTCGGCGCATGTCAACTCTG
GTCCATTTTCCACTGGAGGAGGTCGTCTTTCCACCGCCGTCGGAGTTGGGTATTTTCGTCTTTCCACAGCTGGCGGCTGGTGTGACAACCAGTCTTCGTA
CAGTCGTTGTTCTTTCTGCAGCAAATCTTTATCCATCGCCGACTCAAATGCCAATATCTGCCAGTCACGGTACTTCGCCGAGTTCACGCGGACATATCCC
TCATTGGCCAGTACTCCGTGTGGTTGCCATTTTATCACATAAAAGTGAGGTGGGCACCAGACTGACGTCTGTCGTACGTTCGTAATCAGGACATGGGTTG
GTCTTCCTCGGCGATTAAAAACAACCGTTGGAATCCAGCCCTTCGTCCGTCGCACCCACAAGTCATGCGTCGACTTACTGGGTTGCCGCCTGGCCAATTT
GAACTCAGCGGTCATTCGACTTTCGATTGTTAACCCGTCTGGTGTCCCACATGGGACATTTGGCCCGAACTCGGTCTTTGTCGGCGCATTACTTGATCGG
ATGAGTGGGATCACCATCTCATCGGGTAGCTTGACCGCCGAGTTGTACAGATCCAGACGGATCCCAGCTGGGATCATGAAGTCAGTGCCGAGAATCAAAT
CGACTCCGGCATTATGAGGCATTATCCATACTTCAAACTCGTATGCCACTTCCCAGCCGAGTGTCACCTTCACAACTGCTCGTGACGTTGTCACCATTCT
GTCTTTACGTATTCCTTGTATGTCGATCCGCTTATCTCGGCTGGCCACTCTCTTGAGACGCAGTTTCTTCGCGAAGTACTCACTAATCGCCGAGACATTT
GCTCCGGTGTCCAATAGTCTCTTGGTCCTTCGGTCGTTCACTGCCCCCAATACGAGAGCTCTCATTCTAACTCGGCGATCAAACGTCTGTGCTGACCACC
ATCCCAGCCGTTCTCCTGGAAGCAGATTCATGATTCTGGTACGATGCACAGCCTGGTCTGACTGCCGAGTTACACTTGCAATCGCTCGGTAGTTATCATC
TAACTCACCGAGCTCACGTTCAATTCCGTCGATTTCACACATCCAATTGCCATCCCCGCTTCGTCCCTCGGGCAGTCCTGCTTCATCTACGAAGGCAAAC
AAGAAGTTCGCCTCAGCTGCAGGTTCAGCTGACTGTGGCAGCCCGGCATATTCCATCCCAGTCAGTGTTGGCGGGCCGCCGAATTTAAATCACTCGGCGT
GTAAAGGTTTTGCAGGTCTTCTGGCACTTGCGACTTGTCGACAGAGTTCTTCACGAACGCAGCCAGCTTCTCGTATTGACGAAACAGATCGCACTGGCCG
ACTTCATGGACTTGTCTGCAGAATTTGCAGCGCCGCTGATAGTAGTGAGCCGAGTGCCCCGTTCTTCCACAAGCTACACAAGGTCCACGATGAGAGTTGA
CGCGTGATCCATCTCCACAGTTCGACTGTTCTCCTTGGTTGTACGGTCGCGGAGGTCGGTTCGCTGAGTTTCCCCAACTTCGATTTGAGCCACTCTGGTC
TCCCGCCGAGTTCTCTCGGCGGTCCGGTGTATTTCCTTTATCATTGGAAACGCCGGCGTCTATGTAGTCGTCGTCTTCCGCTGAGTCGTGTCCTCCGGAC
TGGTCCTCATCATCCCAGTCGTCTTCGGAGTTGTACGGACTCGGCGGGTTCTGATCGATGAGTTCCTCCCCGTCGGAGTCAGCGTCAACGACAGTGACTC
GGCGGTCACGGTTTTCTTCCTTGCGACTGCGCTTCTCATCTCGACGTCTATCTCGGCGTTCATCTCGGCGGCTCTGATTCTTCCGCTTGTCATCTCGGCC
TCGTGCAATCACGAGTCGGTCGCGTTGCTTC