Description :
From Genome Similarity Track
Location :
Scaffold_701:37422- 38469
Sequence
1047 bases(100 bases per row)
CATTGCGGCAAAGTCCACCTCTCTTAATTCATAGCCAACTGCGGCGAAGAGTGCATAATCCTCAGCTAACCGACTGTAGTAATTCGAACCGCCCAAGAAA
GATTGTATCGCTCGTAGCGACTGCGGGAAAGGTAGATCCGCCAATGAGGACAAATCTTTATATTTGCCTCCAATCCCTCGTTACAACCGTGATGGCCTGG
GTAGTCCACCTTGCGCATTCCCCTGTAGCTTTTCGCCACACGGATAGAAAGATTCCATTTTATGGCACGTCTCTTGTAGGGATGTCATTCTTTCACACCG
CTGATCTCACGATTCAGCCGGGCTCAAAATGTCGTCGATATAGGATCTGCGCCCCAGCACAGATAGCGTCCCCAATTCGTCTGGTTCGCCTGCTCCGAAT
GGATCTACTTCCGCATCGCCTTCTCCGGATCCACACCCTTCTATTCCCGGGATTCGAGTAAGCCCGTAGAGGGCGTTGTCGATCAGACGTTGATAGATCT
GGGGTGCGTTTTTCAACCCAAACGGCATCCGGTTTCACTCGAACAGTCCAAATGATGTGATGAATGCGGCGATCACGCGAGCTCGATCTTTCATAATCAC
CACCCAGAATCCACTAGTCATATCTAAGGAGCTGTACCAAAGTACTTTATCCAAATCTTCCAATAGCGCATTGATCAAAGGCATCGGGTATATCATCGGT
CTGGTCAGACCATTAACCATCCGATAGCCAGCACACAAATGCATATCCACCCCGTTCTTCTTAATAATGATCACCACAGAAGGCGTCCATAGGAAGGTTG
AGAAGCTGATGGTCTTGGCTCGCACCAAACCTTTAATTAGATCCGATAGTTTTTCACGGAATTGGGGTGCCACCTTCCGCACCCTCTGATCAATCGGCTT
TGCGTCGTCGACATCGATATCGCATTTGACTTCGTGTGCGGCTGGTGATAATGCATTACCCTTACCAATTAGCAGGTGCCGGCTTTCCCAGATTTGCTGC
CGTAGTCGGTCCACTTCCGCGGATTCGCTCGCTCCCGGGTAGTCCAC