Description :
From Genome Similarity Track
Location :
Scaffold_2373:3742- 5054
Sequence
1312 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCGCAAGGGACGTCCCGGGGGCGTAGTTGCATGAGAATCGTCCAGGCGCAA
GATGTTTGGCGAGGAGACCCCGACGCTCGGCGAGATCTCGCCATTCGACATCCTGTCGACTCGTCTTGGTCCCAGTGTGGAGCCAGTGGTAATGCTCCCA
GAAAGCTCGGCGCTGGTGGAACATGAATTAGAAGTACCGGCGCAGCCATCGTTGACACCCGTGGCTCAGGGTCGTCGGGTCCATGACATACATGACCCGG
ACGCGCTGCTGGAACATCTCGTCCCAAGGTCGTGTGTCAAAAAAGACAAAGTAGTCGTCGAGGAAACGGTCGTCGTAGCTCGCGACCACGGNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATAGAAAGGAGAGAGGTCCGCCTTCGACACTTTGGACTTGGCGATCATC
ACAGTGTCCCGCTCGACCGGGATGCCGTTCAGCTGGGTGCGCATCGGGCGATCTGTCTCCTTCGTGAGCGACGGGGGCCACTGGAGCACAACGTTGACTC
CCATCACCGTGTCTACGGGTAGGGTGAGCTGTGACTTGAGCAGAGAAAAGCAACGAAGCTCGAGAACAGGAACATCCAGACCTCCCGCGTTCAGGGCACC
ACTCGTCCGGCGAAGAGTCCGGCAACTGGCCTAGGACCGCCAAAGCCATCGTCGGCAGATCGCACACGTACGATGCACCAGAGCCCGCGCCAAGTCGCAA
ACCCAGGATGCGGCCGCCTTCAGAGTGTCGACCGTGAGCTGCACCCGTTCGGCGAGAGCGGGACGCCCATATGCGGTGCACAAATTCTCGATGAGCGCCG
TCTGCTCCACCATCATGCGCATCATGCCTTGAGAGATGGACGCTGGAACCTCTGTCTCAGTGAGTGACGCCAGCAGAGTGCTGACGAGCGCCTTGCCCTC
GCGGCAAGAGCAGATGAAGCATGGGGATCGGAGCGTCCNNNNNNNNNNAGTGGACGTGGAAACCTCGGGCTCAGCAGGAGACGCCAATAGGGTGTTGACG
AGTGCCTGACCCTCCGGCAAGAGCAGCGAGAGCATGGGGATCGGAGCGTCCGCGTTCTGGGCAAGCGGTTGGCGCAGTTTCTCGAGCAGAGTCTCGAACG
CAGCGCGCCCTT