Description :
From Genome Similarity Track
Location :
Scaffold_86:37419- 40059
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_86-snap-gene-0.29Conserved gene of unknown function
Pytap_DAOMBR444maker-pag1_scaffold_86-fgenesh-gene-0.18Carbohydrate-binding family 9

Sequence
2640 bases(100 bases per row)
GCGAGGAGCTCCTCGATGAGCACGTCCCCcTCGATATTGGGGATGAGACGGAGCCTATATTACGTGAAGAACCGACCACAGTGAAAGGTCAAGCACCAGA
GATCCCGCTTAATACTGAGGGTAACGCCGTCGACAACTTCGCGTCGATAACTCGTGCAGAAGCCGCTGTGCTTGCTGCAGTCGACGGACAGCCTGATCTC
GCGCTTCGACTGGCGTTTCTCGAAGACGACATTGAACTGGTCAAGAAAGTGCTGGGAATGGTAGGACATCCGGCCATGCAGTTGCTCTCGCGTGTCACTC
GCTGTGCGTTGTGTGCTGCTTTCCTCGAGTTTCTTGATGCCGATGAACCCTTGGATACGACGGACTATGCGTTAGGCGACCAATGGCTTGCACTGGCGTG
GATAAAGGACTTGACTGGGCAGGCCGAACTCGTCCGAGAGCTAGACCCTCGAGTGCTGCGCGCGCTGGAGAGACGACTCCAATGCGTGGCTGAGTGGCCT
GGCAAAGAAGGACTGACGGCTGCGAATATACTGACAAGCATAGAGCGCCTGATGTGAAGAGATACTCTGTTGCTCAATTTTGCTTCATGAAGAGTATCAA
TCCATCGATCTATCGCCTCCTTGAGTCGGGCCAGTTACCGTGAGGCACTTGATCGTAGTACGCTATCAAGACCAAGCCCAAGACCAAGCCCGAAATGCGG
AACGGTATGTAGCTAATAGAACTACCAGGCTGACGCTCCATGTTGACAAGTGGAGCCCACTACTCTGCACAAAATGATTGAAAATATGGGAACGAGGAGA
TACGAACGGGACGAGATGAAGATGAAAGTCTTTGAGGCAGCAACGATTAGATTAATTCAGTCGAATGATCGAATGATAATCAAACCATAAAGGAGAGGAC
AAGATACTATTCTGTTTCGGCTCACTGCAAGACTACAATGGCCACATGAATGGAAGAGCGGATCGATCGCTAGCCACCTGACCAGATGAATAGATGCTAC
TGAACGGCAATGCTGGTACGAAGTGAGATACATACACAAGTCTTTCCACACGGTGGAGAATATGAAACATTATCGTAAGTTACATTGGTCATCAATCCCA
TCACTTAATGCATGGAGAGCAAGTCGTCTTCACTCGACCTGTTGCAATTCTGTAATCTGAGCCACTGCATCTCTCTTCACGATGGACAGAAGACTCTCTG
AGTTGATGAATACGCTCGTGAACGGCGCCAGGTCGCGGTTAATCAGTTCGGCCGTGTACGAATCGCCACCGACTTGAATGGATTGGAGTTGAAACCACAG
AAGAGCGTCCTGGACAGGGAAGAACCCCTTCAGCTCCTCGTCCAGAGCCATCGCGTAGTGCCCATGGTGTTTCTTGTACGCTTGTTGCGCATAGAAGAGT
TGGAAAGCAGCACATTGCAGAGGCCACATGGGATCTGTTGGAGGAACGAGCGTGCTCGGATCGACCGGTGGCTTCTCGTCGCGACCTCGGAACTCGAGGT
ACCCCCACCACTCTGGGCGGTGCATGTTTACGGCGTGCTGTGCACTCCAGACCCAGTTCTCTTCCGACAAGCCCGGGATCTTGTCATACCTCCTGCCGTC
CTCCGACACTTGGACGTGCCATTGCACACGGGAAAAGTTAATCCGCCATAATGTGTTGGGCTTGGGTGGGAGTGGATCGGTCTCGACTCGCGTATGGCGC
ACGAGCTCTCGTAATGGTAGCGCCATCTCAACTGTCCAGTAGTGCACTCGCTCCGCTGGGTCgTTGATCCGCCCATCAACGTATACAGCAGTTCGTAGGC
CCTTGCCAAACATGTCGAAGCCGTGGATCGGGTCCACGCGCGTCGAGTTCTCGTGGCCTCCGCTGCGGTAGGGCTTGTCGAGCCACAGGTTCCACGTCGT
ATTGCGAGCGTTCACTTCGATCTCTTTGTAGTTGTGCGTCGAACCGTCCGGATCCACAAACACTTCGAAGTCGTTGTCATGGAAGACGACGGTGTTGCGT
TGGGACTCGTTCGCCCAAATCTCGGGCCCTTCAACGTACGCGCCAACGTACAGGAACTCGTCGTCGTACCGCAGCTTGGCCTTGGTCAAGAACCACGGCT
GCGACCAGTGCAGCGGGCCCTGAATATCCATGAAAGCGTCCGTGAACGGCACGGCCTCCCACACAGCGTCTTCAAGTACACCATCCACGACAATGCTCTC
TTCCTGCAAATGGAACGCCGAGTATCCTTTCGGATGGAGGCTGAGCACTTGGTCTGAGTCTGTAGCACGTGCGTAGACGCCGATAGGTAGCAGGAGCGCG
ACGCTGGCGGCGCCTGTGCGCATGATGAAGCTGCTCAGCTACTGGAACTCCCTCCAATAGGGAATGCCGAGGAAGCACTTCGGTACAAAGGGCTCACaGT
ACTCGCACCCTCtCCTCACTGTAACCAGCCcGCcTCAAGGaGGAGaTGGATCGATGGATCGATCACcGcgttcatcgacgaggagctgtcactcgggcag
tctcgagacaagtcgcgcggcttcNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN