Description :
From Genome Similarity Track
Location :
Scaffold_175:37407- 39625
Transcript NameFunction/comments
Pytir_DAOMBR486snap-pir_contig_175-abinit-gene-0.79WD-40 repeat-containing protein

Sequence
2218 bases(100 bases per row)
GAAGAGGAAGAGGAGGAGGATGATTACATCCAACGCCACTTGCTGTCGCTGCCAAAGTCCAAGTGGAGTTGTCTCGAGGACTCGCAGCAGGCGTTCTGCC
TCGCGATGAACCGCCAGAAGACCGTGTTTGCTGTGGGCGAGCGCGAGGGCCGCGTTAGCATCTGGGACAACATGTCGATCCGCGTGATCACGCGCGAGCT
CGACCCGACGCTGGTCGTCCTTCCCGAGGAAGCTACTGTTGCTTCGGAGGGTGCCGCTAGTACATCAACGATAGCACCAGACAGTAAAGCAGTGGCAGTC
ACGCAGGAAGAAGAGACGAAAGAGAGTGAAGTCGCTGATGCTGTGACGAGTGGAGATGACGGCACTCCTGCTGAAGAAGAGGAAGAGAAAGCGGACGACT
CTGCGACCAACGATGACGGATCTGTGGAGGCAGACGACATGGACGAAGACGACGAAGAGGAAGAAGAAGAAGAGGTCGCGTCTGTGGAAGAAGGAGAGGG
CAACACGGAGGAAGAGGACGAAGACGACGATATGGAGGATAATGACGACGACGACGATGATGATGAAGAGAATGAAGACGACGAACAACGAGAGAAGCGC
AACGCACCAAAGAAGAAGAAAACAACTTCGTCAGCGTCTCAGCCAAATGGAGAAGGTGGCGTGGACAGCGCAGTAGCTGCAGCTGCTTCTGGTGTGATCC
CTCAGGATGGCATCGTCAGTGGTTTGTCTGATGTCTACAAGGGACTAACTCTGGAAGAGCTGCGGATCGTGAAGGCGTCTTTGAAGGTGGTGACCTACTG
CGCGTGGTCGTGTGACACGAGATGGCTCTTTGCTGGCTGCGAGGAGAAAGGCAACCGCCGCGGGAGGTTGTGCGTCTGGGACGTCGAAGCGGCGACCATC
TTTGCAACATTCAGGTACGCCTTCGAGTGGTGTTATATGCGTGTCTGTCTGTCGATCCGTGCGTTTGTTGGTCCTAATGTATACAATTCTTTCTGGTGTC
GATTTCTGTCGTGAAGTTTTGATGCTGCGATCAACTGTGTGAGCGCACACCCCGGCGAGCCCGACCTGGTGCTCGTGAGCTACTACAACTCGCTGCCCGT
GCTGCTCAATGTCCGCGCGCGCACGTCCAGACTAATCGACGTGCCGATTGTGAATCCGACGATCAACACGACCGTGCCAGCGAACAGCAGACACCCGTCG
CTGATCGTCTCGGCGAAGTTTGGCACCACGGGCGAGTGGATCTACTGTGCGACGTCCAAGTCCACGCTCGCGATCTTTGACACTGCGACACTGATGTGTC
TCGACAGCGTGACGCTGCCAGTGCTGATCCAGTTTATCGACTTGAGCATCGACTACCGCGAGACCGCGCTGATTCTGACAAGTTCGAAGGGCATCCACGA
ATTTGCGATCCTTAAGCCAGAAGAAAGTGGCGGTGATAATGATGACGATCAACAGAGTCAGCAATCTAACAAGAGGTCGCTCCAAGAAGCGCGCGCGTAT
GCGACCGGCGCTGTGCGTGCTCCATGGGCGCTTTGCTGCTTTAGCGATGACGAGAGCTTTGTCGTGGGCATGCCGGTCGTGCGCCATCGTCACGTCGGCG
AGAACGGGCTGTACACGTGGAACCGTGCGACAGGAAGAGTGCAGCACAACCCGGGCGTGAAAGACGGTGTGAACTCGTTAGCGTGGGACACCCGCCGAGA
CAGCATCCTCGCGGTCTCGACGACTGGCGCGCTGTTTGTGCTCGAGGAAGAGTTCAAGACGACATGGTCTGGGCCGATGTACCCCGCAGGGTACCGCTTG
ATCACGGACAACGAGCTGCACGTCGCGTCGATGGATTTGGAGCTCGAGGCGATGGAGAGAGCGAGACGAGAGTCGTTTATCGCCCCTCCTAAGGGCAAAG
ATGGAGCAGACAAGGCAAGTGAACCGATTGACATTTTCACGATCGAGGACCCCAAGATCGGTCCCGCTACTGCGCAAAAGCCACCGATGGCGCACTTACG
CGTGCGTTTAGAGCCAGATGTGAAAAGTGAGCTGGTGTATATTCCATCGATCCCCATCGCGCACCACCATAAGAAGCACCACCACGCGTTCCAAGGCCAC
ACGTACAACGAAGAGAAGCACTTTGGGCTGGGGCAGAGCATCTTTGAGCCGCTCAAGGTCCCTGTCAAACCGAAATCGTCCAGGCCGAAGAAGAAAGCGT
CGACCCCGAAAGAAGGTG