Description :
From Genome Similarity Track
Location :
Scaffold_172:3740- 8720
Transcript NameFunction/comments
Phyra_85373Retrovirus polyprotein

Sequence
4980 bases(100 bases per row)
GCAGGTTGCCCTGGATCAGCTTGATCGTCCCACCGTCCCCCGTGCTATCTGGATCCCTGGATATTGCGCTCGTTCTCGTAGGGCGGCCGCGGACGTTCGC
CCGTGGTCGGCGAGCACTTTGAGCCGGGTCAGTGTCTTGGAGATGGACATCGAGTTGCTCTTTCATCACCTGGCAAAGCCTAAAAACTGGCTTTTTCCGC
CGCAGAGTCGATCGCCTCGTCGCGGCGCTTGGTCACCCGGTCTGATCACCGAAAGCAACATTGCGGCACTTTACGCGACGACGCCGTGGAATTCTCTCAA
CGTCTTGGTGACACCTTTATCTTTTGAGGTGACTGGTTGGTTCGAGGCGATGTCTCGGAAGTATCTGGAAATTGAAGATGATCACCGGCAGGCTCTATGG
GAGGCTACGCACGCGTTCATGATCAGCTCCGCGCTTCGTAAATCGAACACATATCTGGCACGTCTTTGGGAAGATCGCAAGCATAGACGATCACGTTTCG
GTGCCGTCTGGAAACGCTTCCTCAAGTTGATTTTGCAAGGGATGATTGCAGGGCACTGCGACTTGGATATTCTGCTGGACCCTTCTTTCTGCATTATCCC
CGGGCGCACGAACAACGAGTTTGGTACCCTGGGCTTGGTAGCAGCTCTCCGCCGTCCAACCTGGTGGACGCCCTACGTGCCGTCGATCTGGTTGACCCGT
GGCGCAATCAGTATCGCGGCCACCTTCAAGATCATCCGAGCTCCTAACTGCCCCGCCTCACCGGCAAATTCTCTCCTGTCGCCGACTAAGATGAAGTGGT
TAGTGGATCGTATATCTTCTCAATATGATCCCCACGGCTTCTCCCTTCGTTGTTTTTCTTCATCATTTTCTTGCTTTATCGAGCATCCCACTCTGATCGA
GAACAGTCGTCCTCGATCTACACAACAATATCACATAAAACCCTTCCTTCTCGATGTGCGGCCTCCCCGCACATCTTTCTTCACATCTTCCGCCCGCAAC
AGCCAACCTGCTACGAGCCCTCCTCCTCCGCCTCATGCGACTGCATGACTCTAAATCGGTTGCGGTTAGTTACCTCACGTTCATACTCAAGCAATAATGC
TCCGCAGTTGAGGTCGGCCTCGTCGACCCATGATGGATCTTCGTAGCCCTTCCAGTACACTTGGAACTCTCGATGAACTCGCCCATAGCGCGTACGCCGC
CCTTATCGCACATCCACAATCCTGTCAACCTCGTATTCGTCTTCGCCAAGGCTGCGTTCCCAACTATCTTCTGGCAGGATTGCTTCGTCAAAATCGAGAC
GATCGCCTTCAACCACGGTAAGCGCCAACGTAGGGCGATCGGGAAAACTTCGCACCAGCTTGAGCTTAGACACGTGGACGATCGGAAATAAGCGGTACTC
CGTGCCGGCAGTCTCCAGTCTCGCTGCGTGATTACCTACCATCTCGACTACCCGGAACAGGCCGTGCCACATATGCGCCAGTTTTCTCGCGTAGCCTTCC
TTCACCCGGTCCAGATACAGCCAGACTTGTGCACCAGCCTCAATCTCCTGGGATCGGACGTTCTGGTTGTGTTCGTCGTCTCGCGACTGGATCGCTTCCC
GGAGCCGCTCATTTACCTGCTCCGTTGCGCGTCGATATTGACTTTGCATGTGGAATCGCCATCGTTTTGGCTCGCGATCACGTCGGCGCGTGCTCCCGAC
GGGTAGCGCCGCCTCCAACGTGGATCGTGGGTCCCATCCGTGGATCAGATAGAACGGTGTGTCTCCACGCACACGATCGTGGGCCGTGTTGATTGCGAAT
GTGAGGCGTTCTGCGTACTCGTCCCAGTCCTGTTGGTTAACATCTGCGACGTACATCTTCAACGCTCGAGTCAACATCTGCACCATACGCTCGGCTGTTC
CGTTTGCTTGGGGTCGGTACGCCATCGTGGCTCTCTGTTTTTGTCCCACTATCCTGCTAAAAGCACGGAAAAAATCAGATACGAACCCAGGTTCCCTGTC
ATGCCGGATAGCCTCACTGGCTCCAAAACGCCGGAAGACGCATTCCTCGTAGTTCTCCGCAATCGTCTGCGCTGTTCTTGACGCGCTCGCTTTAGCGATC
ACATAACCCGAGAACAGGTCTACCCAGATCAACAGCTCCGTATTGCCTTTGAAGGACTTGGGCAACGACGGAATGTGATCCATAGCGATGATCTGAAACG
GGTACGTCGCTTGCACGTTCCCAGGGGATTCTCCTCTCACGAAGGGTCGGCCTTTCCCTGTCTCACAATCTGTACATTCTCCCACATAGCGCTGAACACT
TCGGTATAAGCCCCTCCAGTGGAAGTGTGATCGGATTCGTCGGTACGTCCTTCCGATCCCTTGATGTCCCCCTTCCAGACTTGCGTAGTAATGATGTAGG
AAATCTTGTTGCAGGGTCTCAGGCACCACCAGCTTCGCGATCTCTTCACGGTCCTCCTCCTCCTGCATGGCTGACGGGCAATAGAACAGCAGATCGTTTT
CGTCCAACTCGTAATCGTTCGCGACCTTGGCGCACGATTTAGCTTCAGCCGCGGTGAGAGCCTCGACGTTCCCTTTCAGGTATGCTTTCAGATCGATGAT
CCACTTCTCTTCATTCTGCGCTTGGATGATTCGTTCACCGCGCATGCGCTGTACAATCGTTTCCTGCAGGACTTCAGGAGTCAGTCGTCTGCGTCGCGTC
GATCTGGTCACAACAGACACACGGACGACGGCATCGTCGTCCCTCATCTTGAGGAGCTCGTCCAAACGGTTGAGCGTGATCAAGTCTTGTTGATCTTCGT
CTGAGGTGACTACGATCCCTTCGCCCCGTTGGAGAGCTTCACTCGCTAACTTGTCTGCACTCTGGTTCCAATCTCGTTTCATGTGTAGGAACTCGTGTTT
GGCCACGACCTGAGCCGATCCATCGCTTTCTCGCGCAACAACAACAGGCCAGGGGCCTTGCATGCGATCTCACCACGCATTTGCCGGATAACTAAATTGG
AGTCGCCGCAGATCACAATCCGCCCCCTGTCCATCGTGGACAGCAGATCGAAGCATAACAACAACCCGCGGTATTCAGCCTCGTTCACCGTCAGATCGGG
CATATACTCCGACGCGGCGGTGGAGATCGTCCACTCTGGCAACTTCCATATGATCGCACTGTAAGCTCCACCACTGCGTTTGACGCGTGCCGATCCATCG
AAGCTCGCGACCAACAAAGTTTCGTCCGCTCCGATCGTAGGGGGTGGCATGGTAATCGTCTGTCGGGGCTGCTTCACGGGTGCGATCGCGATCAACGCCT
CGTCTACTTCCGCTCGAGGTGTGATGCTTGCTGCCATCGTGCCTAAGATTTCGTCTTCCCCTTTCGTGCACTTCCTGATCTCCAGTGTCCATTCTGATAG
CAAGGCTGCCCAGTTGCCAAGTCTCCCTTGGAGACCGGCCGAATTGACTAACCAAGCCAGCGTCGAATGCCTGGACAGCACCAAGATCGATCTCGTCGTC
AACAGGGTGTAGATCACGTCCAGCATCCGCAAGGGTGCCAAGACTTCTTTGTCGACGTTCCCATAGTTGGTCTCGTTGGATTTTCGAGTACGACTGGTGA
AGGTTACTGGCCAATACACACCATCATGCTCTTGTACGAGTGCCGCGGAGATCGCCCACTGGCTCGCGTAGACCACGATTACCGGGGTGCGATCTGGATC
GAAATGTTTCAATACCGGAGTGGACACGATCTTGGCCTTCAGCATCGTGAATGCGATCTTCGCTCGGGCCCAGCGGTCAGCATCTTCCGCTCGCGTGACA
ACGCCCCCAGCTACTTGTTCGCTGGGAATGGATCTGTCCTGTCGGGCAATCTCGTGGAAGTCCGCTTCGCGCAGCTCGTATAAGATAGCGGCATAGACCG
CGAAGTCTTCGATGAAGCGACTGTAGTAGTTCAAGCTTCCAAGGAAGGACTGCATCGATCGCAGAGTCTGCGGGAAAGGAAGGTTGCCTAACACTTCAAG
GTGTTTCGGATGGGCTTCCAAACCGTCGGCGGACACTCGGTGTCCCAAGTAGTCCACTTTTCGTCGGCCCCAGAAACTCTTGACCACGCTGATGGACAAA
TTCCATCGCTCGCAAGTGTCGAGCAATGCCTCTACCTTCTCACACAGCATGTCCCAAGTGATTGCAGTCACCAGAATATCATCGATGTACGATCGTCTTC
CCAACACTGACTGTCTCGGCTCTGGTTCCGGCTCGCCTGACTCGAACACGTCGATCGGCTTCGACGGATCGTGACCGGCGCGGATTCGGAAGTGTCCATA
CAGCGCGTTGTCAATCAATCGATGGTAGATCTGTGGCGCATTCTTCAACCCGAAAGGCATACGCGTCCACTCGAACAATCCGAATGGCGTGATAAAAGCG
GAGATCTTCCGTGCGCCCTCCGTCATGGAGACTACCCAGAAGCCACTTGCCATATCGAGTAAGCAATACCAGAGCACTTTGTCCAAGTCTTCCAAGAGAT
CGCTAATCAGCGGCATGGGGTACATCATCAGTCTCGTCAAACTGTTCACCAGCCTGTAGTCGATACAGAGCCGGATGTCAACGCCGTTCTTCTTGATGAT
GATTACGATCGGAGAGGCCCACGGTGAAGTCGACGGCATGATCATCTTCGCCGATAACAGGCTCTTGATCAGATCCGACAGCTTCTCGCGGAATTGTGGA
GCGACCTTCCGGACGCGTTGTACAACAGGAGCCGCTCCTCCCACATCGATGTCGCAGACTGCGCCAACGGCGGCCGGCGGTAGCGCGTTTCCTTTCCCGA
CCAGAAGATATTTCCGTCTCCAAATTATCTGTCGCAGCCGATCGATTTCTTCCGGGGTGTTCGACTCTGGATCGCCCATCTGGATATCTTCGATCGTAAC
CTCATCAGTGGCAGTCACTACTTCTGGTAGAATTGCCAACTGACGCTCCACATCTTCGGCGAAGAGATCGCCACCTTCGT