Description :
From Genome Similarity Track
Location :
Scaffold_31:373927- 379064
Transcript NameFunction/comments
Phyci_191634Hypothetical protein
Phyci_186795Hypothetical protein
Phyci_6184Hypothetical protein

Sequence
5137 bases(100 bases per row)
CTCTATCGTTCCTGAGTACCTCCGTGGGATggaggggtagatgtacacgaccagatccgcctcaagcgatattcgatccaaaagactgtggcgatgcgaa
agtattacaagcaacgttttcttggtttggtcgatatggcaattacgaatggatttattgttcataaatttgttcagcgacagcgtggagagaaAATTAC
AACCCATGCAAATTATATGAGGCTGCTTCATAAAGAACTTCTTGCGTTAGAGCCTGCGGATTTCGAGTCAAACATGCTCGgcgagaatttgcttagccag
ccgttgagatcagaatcacacatgatgactcaagtgacggagcgctaccgagtgaaaaacaaaacgaaaaaaaaacggcgtcaatattcctgcaaagtgt
gttctgccttgagcacaggaaagagttcggaaacgacgtacgtgtgcatgacttgcgatgttgcattcggtggacgtgttgcactgtgcaatctagttcg
ccgtgttgaagatggaaacagtctaacatgctttcaaatatggcataattcgtggaaaaatggtacgcaaattccaagtcaatataaaaaaaaaatcgat
tcagacgggatagacgaaagcatagtcaagtcgattcatccagtgacagcgaccccatgggctcgagcacgtagttgattgatgtatccgcaatagcacc
aatgctgctgcgggcgctgatacattgtacaaaaccggcaatgacagcatgggcacggacgaggcaacgtccatcaaggtttcgtgctgagcccggcgaa
gaccatgcgcaacgtcaacagtgcgacgctgaagagcgtcggccgtggcaggttggtcgtgagcgctggccagacgagtgatgtgtcgagcgcggacggc
aacgtggacgtatcgagggctgcgtcgaacgtgggcaacaatgtggatgtgccgagcggcccttatacgagcgggaacgtgctggagcgcgatgcgaacg
gcgtgggcgtcacgtcgggctggttagatggacgaccgctcgttgctggtgggcacaaacatcgtcgtgagcactggcagcagcaatggcagcagcggcg
ggaccgcggcgctgaatgtgggcatgggcaacagtagtgctgtcgggtccatctcgctgcggtcggccgagactcaatagcctacgcgacgaccggaact
gtatgcggtttgatctcgctgagcggtggcaacggtgtgtaggccagccgtcgatctcacggtaggtcggcgtgagtgtatctacgtcgagcggcgacat
ttcgttgacgacgctgcaagcacaagcggtgcgattcgcgtgggagacagagtatcagtgtgtcgatctttttttcggtaggagcaggagacatgacgtc
gggcggtaacgtcgtgctgtcgacagccgactcccgttgacttcatcggcgtcgagcaggagcttcaccagcgtggtgagcgggcgcggcagcgagcttt
agcaggtcgattgctgtaccggtgggtctgcgggtcggtctggcggtctgagctttagcagcggcagcgcggctgcgggtgcctcacgtaacttgttgtt
gagcagtagagcagatgtgccagcggcgggtccgtggagatgagactggggagcggcgacacggggacaatttgtcgatcgcggcCGCCCGCAGCTACGG
CACAAAAGGACTTGCCGGCGGCCCAATCGAGCTGGTCGGTGGTATGGGCTGGGAGACCAGCCAGTCTATTAGCGTGGGCAGCGGAGTAGGTGGTGATATG
CGACGTTGACAAGCGGCGACCTGTCGCTGTGGAGTGCGGCGTCTCACTCGAGTGGGTCTATGTCGCTACGAACATGTATGGGGTGGTGATGCGGTACTGA
CGCCTGATTGTGAAGACGCGCGCCGTGCACATGCACCGGCAGGAGCGGCAGACACGCATCGAGAAGGTGGCGAGTAGTGAATACTGCCAACTCCGCGTGA
GCGAAGCATCAGCGAGGCGATGACATTCTCTGTTGGCATTGAAGCTACTGCGCATGATAGCCAGCGTATCTGCACGGGTGCGTCGACAGAGGAGGCCTCT
TTGACGGCACTGTTGCTGTGCTatctggtggtgctaccgcatcctgtacaagcagaacttgacggtgttcgtgtatgggcgactaacagcgtgatgccga
agataccggcgaccctgctcgacaatggggaggtgcgaattccgcataggtctgagaatgatggaggagtgggtctatttgttgtgatggctttctcgat
agcaaagatcactttgctgaagaagtcgttctgggagaagtacggtgacgatctcgtgaaatccttgaaagctgatctttgcgcctacctccagaatgtg
atcgtgatcaccatgtgtggtgatgtggcagaggtcgacacgcctatccacactagctcggaggctgctgcagatgctgatacaatgtaATAGGCCACCG
AAGGCATCCAGAGGGTGGCGAGTGGTGAATACTGCCGGCTGCTTATGGCGATTCTCGACGCGGCTGACGCGGAGCTCAGAGCGACATGAGAATCGCCATC
GTTGTCTGGATGCGACTGCGTCGTAGAGTGCAGCTATGCGCAGCTCGATTTCGAGAGTGGGTATCGGTAAGAGGATGCGGGCTCGAGTACGCACGCAAGT
TCGACGCAGGGTGCGTCTTGTTGTTCAGTGTTGGCGACGTTTGCCGCAAGCAGCAGCGAAGGAGACGCGACTGCCTGCGAGGCTATCGGTGCTGTTGCGT
TGAGCAGCCTGTACGAGCGATGTATGCACGAGGGTCAGCATCAGCGAGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN