Description :
From Genome Similarity Track
Location :
Scaffold_112:37391- 39345
Sequence
1954 bases(100 bases per row)
GCTGGCCCCGCTAGCAGATCCACAAAGGTCAGACACTTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCCGACTTGACTTTGCTGATCCATGTTCTCG
CTCGGTCCTAATCTTGATCCTTGCCCGTGAACTCCTTCAAGTCCGATATAGCTGAGATCCGTACCCTCTGGATCATGGACGATCCACCTGCTCCGGCTGT
GGCCGTTGCTACCACGGCTGCCGAAGTGGATGGGCCATCCAGATCGTCTGGGTCGAACTCATCATGGGAGTTGTCCCCCTCTACTGACTCCATCTCCACG
TCCCGTGCTCCATGTTCATGGAGCACTTGCACTTGTGGCACGGGCGCTCTCATACCCTGTTCGGCCAGGAAGCGATTCATCGCAGCTTCAAAGTGCCGTT
GCAGGGTGCCCGCGGAAGTGTCGGAAGAGCCTGTGGCCATCTGGTCCACTGGCGGGACTGGATCCGTGAGGCGATTACCTCGAGCCTGATCTGACGATAA
TCCCACTGGCTTCTTGCCGGATCTGGCTCGATCCTGGCTGGATTGTGTCAAATCACGCGTAGGGCGTACTGGATCCCGAGCTTTCACGTTCACCGGGGCT
TCCTGTCCTCGGATCCTCGCCCGCGCTTCCAGCATGGATGCCCCGGAGGGTCCTAAAGTCATGCGTCGTGGTTCAGACGACGTGTCTGACTCATCCTCAG
CGGCGGATTCGTAGTTTGAGGACGCAGCTTGGCTGATCCTCGGCGACGACACTGGATCCATAGTGCGCGACCTTTCTCCGGTGATGGACTTAACTCTGGC
AAAGAGGTCCCGCGTCGCGGATACTATGAGATCCAGGTCTAGCTCGAAGATATCCTCTGCTTCGAACACACCAGCTACGATGCCTGACTCCGTAAGCAAA
CGTAATAGATCTTTGACTGCCACCAACTTGTTCGCCGTTTTCGTTGGTGCTCTCACCGGTTCCCTTGGATCTTCGATCTGTCGTGGATTCAGGATCTGCA
TGACAGGATCTTGATGCAGGAAGTCGCGTAAAGCTTGGTGGCGATACACAAACTCGAGATCCTTGTCGGACCAGCTTGACCTGGATCCAGCTTGGTCTTC
TTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTTTTCGTCTTCTTTCTTGTTTCTTCGACTAGCAGGCTTGGGTTTAGGTACGGTGTT
GGCTTAATCGGTGAATCTGCAAATGCATACCGTTTCGCCTTCACTTTCCCTTGTTTTGTTAGCGGATCTTGACTTGCGTCAAGATCCGCAGGGTCCCCGA
GGGACCTGGGGAGGATAGAGAGGTTTCTCTTCTAGATCCGGATCCGGATCCACCTCTCTTCCGTCGACAGAGTTCCTCCCAAAACTCCATCGATCCGCGG
ATCTTGTTTCATTCAGCAGCGTCTTCGTCGATCCGACCTCCGACGACGCCTCTTCCCCTGGCTCAATCTTCACTTGAGCATCTTCTTGGGACTCACGGTG
AAATCCCGAGTCACCAAAAGATCCGGGCACGCGCACCATTGTGGTGTAGCGGGATCAGCAAAATCTGCGAGATTGCCAGATCCAACTTACCAACTGCGCC
CAGACACCGACTAACGGAGGGGGTCCCCCGATGATCCGTGTTCTGCTGAACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCGGGATCTGCTCTCTCGGT
AACTTCCGAAGAGTTCAAGTGGTGAAGCTTGAGTGTCTTGGCGAGACGTGGGGATGGGGTGGAGCAGCAGTGGAAAATCTTCACTCTGCGTCCGTGGATG
GTTCCGTATCCTAAGCGAATATTCGAGCTTATGGATCCGGGGCCTAGATCGTGGATCTGGCCGTAGGGTTGCCTTGCGGGTGTGTTCCCTTGCCTTTGTG
TTGTCCTTTAAGTCGTACTTGCCGCCTCCTGTGACGGGATCTTGAAAGTTGAGA