Description :
From Genome Similarity Track
Location :
Scaffold_35:373894- 378743
Sequence
4849 bases(100 bases per row)
ACGTCTGAAGACACACTTCTCATAATTCTTCGAGATCGTTTGTATAGTTCTGGACGAGCTCGCCTGTGCATTCACATCGCTGGTAAATTAGTCGACCCAC
GGTAACAGCTCCATATTCACTTATAAGGATTGCGGCAACGAGGGAATATGATTTATAGCCAGAATATGAACATGGTATGTTGCTTGAAAATTACCAGGCG
ACCCGCTCCGATCAAAGGGTCGTTCCAATGGAAAATAGCCCTGATCCGTTGGTGAATGCGTCTTATGCTTTGGTGGTGTGGTAAGGTGCTTTTCAAAATA
GGTGGGCCTAGGGTCCAGTGAATTTAAGGAACAAGGGACAGCGCACTAGGACGAGGGTAACATAGAGAAAGGAATGTAAAACTGCAGCAGGTAGATCCAT
GTATGCATCGGCAGTACTTTTTGCTCATGACAGAGTTAATATATCAAAAGATCCGGATATAACCGGATAATTTGATAGAAACATCAACACTAGTTGAACC
AACCATTAAGAGGCAGTTGGTCATGACAAAAATGGACTATTTTCAGCTGACATTAAGCCAATATGTTGGCGTGCCAGGTCAATGTGCGCTAATAAAAAAG
CATCTATCGAGTATCTGTCCAATCGCATGAGCCAAACATGTAGTAGGGAATGTCTTTAGCTAAACAACACATGGATCACTACGTCCAGCAGTATCAAGAA
TAGTTAACCTGATGCCATGGACAGCGAATCATCCGACTTTAATTACAATGAGAGGTAATTCGGTGCATGTACGAAAACGGAAGACTATTTGGCATACATA
AATTGCTGGTTGAGTGTTTCCCACGTGTGTGAAATTTGCCGGACTGGCGAACTGCTCAATCTGGCAGGGGATCGACGGAAATTGTCTATTGAAGCCTATT
GTACAGCACTGAAAGAAAACGTACTGCCGATCACTTGAATAAATGTTGTATTATAAATAATGTGGCTTCTCGTTAGGTGGCTCCTTTCCACATTTCCAGT
CAAAATTATATGTGTGCTATTTGTTAAACTTGTTACGCAATTAAGCAATATTAACGTTAAAAGTGCCGCTAATATGGAAATGCTTAAATTATATGCATTG
AATGACTCAAGACAACTCAGAACTCTAAATTCATTGATCAGCCTTCTGCTGATTGATGATGCTTTCCAGCACCCTCGTTGTCCAAGAAATTGTCCATCCA
CAACTCAAGCCCATCGTTCCAATTATGCAACATAATACAATTAAGTTTTTCCTGCAGGAGCTACTAACAACCTAAAATAATATAGGAGAGCAAACTCTGG
ACATCGCCTTGTGTCATAGGTAATTTAGTTCAGAGAACCAAATCAATTTCTGTAGATCCATGTACCTTGCGCTCAGTCGCTATTAGCTTCACCCTTTGGG
CTCGCGAATAATGCTATTGATTAATGAAGAGAAAATAAATGCCACGTCGCACTTAATCCAACGTGTAAGGTATATTTAGAGTTATTTACAGAAACAAACT
TTAGAGGGACCGGGTTAATCGTACTTAGTACGACGTGTAAGGTATATCAAGGGATACCCACAGAAACAATAAAAGCCTATTTATAAAGTTAATTGAGTGG
CCTTTCATCTACTACTTCAAAAACTAGATCTTAATGCAGCACCTTTGTAATTTTAAAGTGACACAATCTATTTAAAATGGGTTTAAATATTTCAATACAC
TTATCAGAGTTGGAACTGCTTTTTAACTTAGACGAAACTGCCTAAAATTATGAATGACTGAGTAAAGTGGAATATGATTCAACAAAATCGAACGACGATG
AACATATTGGTTGTAAATTGAAACGGCTGCATAGAAGATTAGATTCTGTGTTTTTCTAGAAATTCCACCAAACAAATTGTGAGTTTCTTGCCGTGGCGTG
TCACGTGGTCGACCATAGATAACGAGAGAGTGTTGAACTCTAGCAACTGAAGGTAATTAATGGTCCAGACGGCGTCGGCTCCGCGGATCGTGATTAGAGG
AACAATGGTAGACAGGCACTGGGGAGCTGTCAATATCGTTTTATATGTCGACAAACGTGGATTTGAGGTACAGCTTCTCTTAACGGTAGGCTCTTGCTGG
TCGATCATCTCAAGAGCTTAAGTAAGCTGGCCTTAGTCCGCGGCGGAAGCGTGAAACGAGACATGGCTGAAGTGACTTGTGTGGGCTTGGAAACGAGTTA
AAAAAATGCTCAAGTGGAATATTGTATTAACATTTCAGCAGCAAATATTGTATTTACTGAGCAATAAAATAAGGTAGTGACTAGGTAGACACTCCCTATT
TACATTGCGGACACCCCTTGGATAAGGATATAATCTATACATTACAATACTGGTGCCTCTACTTACAGCGCAAACATCCCTTGGATAAAGATATAATCCA
TATCTTGCAATGCCGATGCCTCTATTTATGGCAAATGCTAAACGATTGGTCATTTTTAGTCGGCTGGGTCATTCTATAAATTTTCAGAAGTAATTTAGAA
GTAACTAAAAAGTGACTCAGAAGTATGCCCAACTTTATTACCCGTAGATCCCATATTTCTCAATTCTTTATCACTATTTACTCACTTGCCCGTTCAAGCT
CATAATGAAGATATCTGTACAAAACAGGCTAATACCCTACTCCAATCCTTCCTTACGCTGCTAGCATTCCATACTGAAAATGTTGGAAAGTGTTCCACTT
TCCGGAGCCGACGCTTAGGGTTCACGCTAGCACGTGTTGCAAGGGTAAGGGGAGATGTTGCAGGTGGGCACACTATCTGTGAGAGTAGTAAGTGACTCCC
TTCGTAATAATCCACAAAGTTCTTGGTCCTCTAGGTCTGTTACATCAATTTGGAGGTTATGAGCCCAACCTTTACAGCGTATATTAGCACCATGCAAATA
GCGGCCTTGTTTAAGGCCAAAAGGGAAACTAGCACCAGCTGAAGCGAACATTTTCTGTGTTTGGTGGCCATCAGAAACGGGACTGGTGCGTCGTCGAGTC
TAAGCTTAGAGAACAATGTGATGTACGCTGTCCAGGAGATGCGAATCATTTTAATTGCAAAATGGGACAAGAACCGGCTTAATTATTGCGCACAAGCTAG
CTAGCTAGCCAATTGGTCCGATGAAGTGGATGCTTCTAACCCGAGCCTCCGCAGTGTGGTTCAAACGGTGTATGTTTGTAGCGACGAGGACACTTGAACC
TGCTATAACTGTGGATGGGTCAGGAACATTTCCTTCACATGTAATCGGGCAAAGAAGGAGCCGAGCGGCGATAAGACGGGCCACTTTGTGGTATTAGCCG
ATGAAGAAGCTACGAATTGCCTCTGGATTTTGGATTCAGGGACTAGTCGTCATATAGTGTACGACCCTACCCTACTTTACGACGCCGTTGATTGTGAAGA
CTCAGAGGCACCAAAACAGGCCGATTGTATTCCACTCAAAGTTATTCGTAAAGGAAAGGTGGATTTACGTGTGCGAGTGGGTCATAAAGATGCCAAGATG
ACTCTTAAAAACGTGCGGCTAGCCCCTCAACTGACGCTAACTTGTTGTCGTACAAACAGTTGCCGAAATCTGGGTGCGAATTGGTTAAATGGAATGGAAC
TCACGCATTAGTGAAGAATGTTCATACCATGTTTTACTTGGCTATGATGAATGACGTGTTAGTAGTTAGTGATGCGTACGATCCAAGCGAGCAAGGATTT
ACGAAAATCGTTATGGATGCGGTAACTGATACTAGTGCTAGTGCTCAATACGGGCACAGAGGCGCCCTGATGGAATTCCATCACCAATTTGGCCATTTGG
CAAATGACACTATTGATTTCATGACCAAGACCCCGACATGGGGATCTTGTTGACTAGCACGTTAAGAGAAGTGTTTGATTTGAGCCTAGGTCAAGCACAC
CCACGCTAACCATCCTAAAATGGATACAGGTAAAAGTACACCCACTGATCGTGTTGGAGCGGTTATCTGTAGCAACATCAAAGGACCCATAATATCCCGA
GATTGCAGCGCAACCGGTACATGATTCATTCCATTGACCACAAGTCGAATTATTGCCGCATCTTTTTGGCACCCACAAACGATCAGGCGACTAAACTTTT
CCAGCATTTTTAGTATGGTCGGGGAAACGCTTAAGATCAGGCGACTAAACTTTTCCAGAATTTTTTATTGTGGTCGAGGAAACGCTTCAGTTGTCGCATG
CACAACTCCTTGCCATGAATTATGCTTTGGCGAAATTCAGGGTCTACCTACTAGGTGATAGACCCTTCATCGTATACAGGGACCATGCTTCCTTACGCAC
GGCCGTTAACAGTCCACACCTCTCGCAACAAATGGCGAGAAGGTTGTCGTTATTTGCGGAGTATAACTTCTCCGTAGAATATAAACCAGAACGACTGAAT
GTCGTCGCTGATGCTCTGTCGCGCCGGACCGATTTCGAACCGGCTGCGCGACCCGACACTGGTCCGACCACTGTCGCGGTGTTGACATCGAGTGTCCCGT
CGTCAACCTTACTAGAAGGCATACTCCAGGCGTACGATCCGGCGATGGTGCGTTTGATCGAACATCTCTCGCAACCATCCCGTCAATCTCTAAAAGGTTT
CCCCCAGTATATCGATCCTCCACGGATTGATATACATTCCACAATGGCTTACTGAAGTATACAGCCGTTGCCGGCGACACGCCTCGTGTCGTCGTACCGG
ACCATGGTGACCTGCGACTGCGCATCATGTATGAGTACCACGATGTACCTACTGGTGGAAATCGTGGTCGAGAGAATACATATCTCACAGTTAGTCGCGA
CTTTTACTGTCTTTGGATTCTCCGCAGACCCACACAAGAATACAGGGTA