Description :
From Genome Similarity Track
Location :
Scaffold_41:373834- 375590
Transcript NameFunction/comments
Phypa_INRA-310PPTG_14792flagellar protein

Sequence
1756 bases(100 bases per row)
TCACTACTACTCGCAGCGTAATGTCCATTGACTAGAACTTGAACAGACGTCCGGAAGCGATCACATTCTGCCTGGAGCGCCATTTGATAAATCGCAGCGA
CTTGTTGGCATGTGTCTTCAGTCCATCCGTCACCAACCATACTACTGAGCCCTTCATCGTTTTCTTCGGTTTTAGTCTCGATGAGAGATACCAGTTCATC
TTGAAGGATATCTGCACGAGCGTGAAGCTCTACCTTTGTGGGGTTATCAAAGCGCATCTCATCAACCACCTCGTTAAATAGCCGTTGGAATTCATTAACG
ATTTCTTGCTTTCGGTCGGGACGGCGAACGAACTCGCAGAATTCACTCGTTATTAGCTGTGCACGTTCGGTCACACAATTTCGCTGCTCTCTTAGTCGCG
CAAAACTTGTCTTCATGGTAGTAATATACTCCGCCTCCATTTCATCCCACAATGCCGCAAGCGCTTGGGCAATTGCTGGTACCAACTCTCCAGAGTATTT
ACTGTTTGGTACAGGACGACTCGATATCTCTTCTTGCATCCAGCTCTTCACAGCGGCCAAAACACCATCGAGGTGACGTTGAGCTTCCTCTAACTTCTGT
CGAAGTTCCGCCATCTCCTCTTTCTTTGCCTTTGCTTCCTCCGCTTCAGCTATGGAGGCCTCAGTTTTGATAACAGCTACCTTAGCCTCGTCAAGTTCTG
ATTCAAAGATGTCCAGACGTCGTTGTCGTTCGTCCTCAGTTGACATATGAATTTGCTCATCTGCCTCATGCTGGAGCTGCTTCGAGTTTACTTCATCTTG
TCTCTCTTTCAGTAAATGATCCACAACACTCGAAACAGCTTCATGTACTTCATCTGCTGTCATTTCAGCGTCTGAAGGCTCATGAAGTGTGTTGAATTTC
GAGTACCAAGTCTTGTGATCGTGCATGAATCCATCGCTCGCCCAACAGTGAAGTGATAAAAGCTCACTTGAAAACGCGCTTGGGTTGACATGCTGCAGTC
GATGCCGTTCAGTTGAATCATCCGGTGGTGGATCAAACACTAAATGACGCTTGTCTCCTGCTACGATATCCTCAACTCGACCCAAGCATCGGTCTAACAC
CGTGCCAATTGGACAGTCCAAATGGAAAACCAGATCAATCCCAGATTTACCTTGCAGGAATGTCAGAGATAACGGTGGCTTACTGCGACCTGGAGCAATG
GCAGATTCAAAATCATACGGAGAAGAAATATCTGCGGGGTCTTTATATCCTGTGAGATGCTCCTCCAAATTCTGGCCGTGTCGAGCTGTTGCAGGCAGAT
CGTAGACAACCCAGCCAGCTTTACTATTACTGTCTTGTGTAAGCGCTTGAGTTTCAATCTCACTGATAACGTCGATCACTAGGCGGCTGTAAAGCTCCGG
GGGAATTTCCTTCCCGTTGGAAAGAAGATCATTCACTTGCTGACCAATCTCACTTAAGTTTTGAACAGCAGTTTGAATGAGTTCATGGACAGACAGCACA
ACCAGATTATGCGTTTCACCGAGAAGCTTTGCTTGTGTCTCCTTTCCGGCAAAAGGAGGGCCAAAGATCAGAATTCGGAGTTGCTGATGTGATAGCAGTA
CAGGTCGGTTAGTGCTTGACACAGCACTAATTTCGTCAAACTCGTCTAAAGAACGAGAAATCCACCGCAATGCCTTAATTTCTTCCCCAAGAACAAAGCA
GTCCTGTACAATTTCCGTGGCCCCGGGGAAAAGATATCCGTCGTTGCTTGTCTCTA