Description :
From Genome Similarity Track
Location :
Scaffold_9:37382- 39354
Sequence
1972 bases(100 bases per row)
GAACCCCGTGTATGCACTTGCCAGGGAATTTTAAGACATTTTTCCAGACAAGGTCCCGGACGAATTGCCATTTGATAGAGGCATTCGTCATGAGATTGAC
GTACTTCCTGGCACGAAGTACTGCATCGCAAGACAGTAGCCGTTGCCAAAGGAACAAGTCGAGGCAATCAACGAGTTCTTTGCGCAACGTGCGAAGGCTG
GCCATGTGCGAGAGAGCAAGTCTCCGCATTGCAGTCCCACTTTTTGTGTGAAGAAGGCGACTGGCGGATGGCGCATTGTTCACGCTTTCAACAAGCTGAA
CGACGCGACTATTCCTGCTCAGACTCCGGTTCCACGCAAGGATATGATCCTTGATGGAATGGTTGGCAGCACCGTCTTTAGTGCTATCGATCTGAAGGAT
GGATTCTATCAGATTCGAATGCGCGAAGACGATGCCCCACTAACTGCAGTGAGTACCCCTAGTGGTATGCTGTGGGAATGGTTAGTGATGCCACAGGGAC
TGAAGAACGCTCCTGCAGCTTTCAACAGAATAATCACGAACGTTCTTCGCCCTTTGCGAGCATTTGCATCGAGTTACTTTGACGATATCTTCGTTTATAG
TAAGGCCACGGATGGGAGATCTGACGTTGATGTTCATCTTGATCATCTTCGTCAAGTTTTCCAGGTCATGTGTGAAAACAAACTTTACGCAAACTTGAAG
AAGTGCATGTTCTTCGCCCCCGAGATTCCTGTTCTCGATTGTTTTGTGGGCAAGAATGGTGTTCGAGTCGATCCGGAGAAGGTCAAAGCTATTGACGATT
GGCCTGTGCCTCAGAACGTCAAACAGCTACGCCAATGGTTGGGTCTGGCCAACTATTTGCACAAGTACACGCGCAATTATGCAGCGTTAGTGCAACCGCT
CACGAAGCTCTTGAAGAAGGACGTTGAGTGGAAGTGGTCGAAAGACCATCAAACGGCGTTCGAAGAAGTCAAGAGGAGTCTTCGTGAAGCTCCTGTGTTG
GCTCTACCGGACCACGACAAGCCGTTCCACGTCGTCTGTGATGCGAGTGATTATGCCATCGGTTGCGCATTGATGCAACACGATGATGAGGGTCGAGAGC
GAGCTGTTTCGTATCAGTCACGACAACTCAGACCCGCAGAACGGAACTATCCAGTCCACGACAAGGAGCTACTGGCAATGAAGTATGCTCTTGTCAAGTC
CCGTGTCTATCTGCTTGGCGAGGAGCGCTTTGCGATCTACACAGATCATGCGTCGCTGCGGACAGCAGTAAAGACTCCTCACTTGTCGCAAAGAATGGTG
AGATGGTTCTCCTTCTTTGCTGAGTACAACTTTGTTGTACACTACAAGCCAGGCAAAACGAACATCTTAGCCGACGCATTATCAAGACGTCTGGATTACG
ATCCAAAGTCCAAGAGTGAAAATATGGACGAAGAATGTCGACTTTGCGAAGATGTTCAAGCGGTCGCAGTTCAAGCTACGACGACAGTGCGAGAAGAGAT
TGTCGAAGGGTACAAGTCTGACGAAACTTGTCAGGACTTGTTGAAGTACTTCAAAGACCCTTCTGACAAGGCACTGCAGAGCTTGCCTGCTCGAACAAGA
TCGCGAGTTCATCGCTTCCAAGTACACAATGGGTTGTTGTACTATGCGGTTGAAGACGGGGATGCAGCAAGGCTTGTTGTTCCTAACGACGAGGGTTTGC
GTCATTGTCTCTTGTATGAGTACCATGACAGCCCCTCAGGTGGCCATCTCGAACGTGAGAAAACGTTTCTCAGTCTTTCCCGGGATTATTACTGGCCACA
CATGTGCAAGTGGGTTCGCAAGTATGTGAGGACTTGCGAGATCTGCCAACGTGTGAAGCCCTCTGGCTTCACGCAAGCCCCACTTCGTTCATTGGCTGTC
CCATCGACAGTTGGAAGTCTGTGAGTATGGATTTCATATTCGGACTTCCTCGTGACAACACGGACGCAATGG