Description :
From Genome Similarity Track
Location :
Scaffold_70:37376- 40381
Transcript NameFunction/comments
Hyaar_Emoy2807826phosphatidyl inositol kinase (PIK-A)

Sequence
3005 bases(100 bases per row)
GAACGCATGGACGTAAACAGTAAGACGTTGCTATCCGCCATCGCCTACTTCAGCTTTGTTGCGACCTTGTGGATCCAGTCTACAAGCAGCGGAAATAGAG
CAGATACGCTGTCGTTGATGAGACCCAAAAAGAATTGCTCGGCTTGTTCGTCAGTCAAATCCAGACGGAACTTTTCCTCGACCTTCAGTAGCGTTGTCGC
AGGATTTGCTGATAACTCTTCAATACCAGAATCGGCCATCAAACTGAGCAAGTTCAGAATCAGATCAGCACTCTTGCGCAACCAGTTGTACGCTTGGCAG
CAGTAGGTCGTAAACTTCTGGTAATGCTCGCTCGTAGGTCCACCCATGCCCTCCACCATTTCTTTGGTAAGCTTGAACGGAGGTGGATAAGGCTTGGGGT
CGGCGCCAAATACAAAGCCGAAATCAATGTGAAACATGTGACCTTCAGCTTTCATCATTAAATTATCCAAGTGGCGGTCTCCGATTCCAAGCAAATACGT
CAGTACACAATAACCTGCCACTGATTTCACGTATGTGCTTAAGGCTTCGGGTGCGATCCCAAACTCTGCACTTGGATCCGGGTTATGTTTTCGCAAAAAA
CCCACGATTTGAGGCGACTCGAAATGAGAAACCACGTACGATACAGGATAGGAGTCTTGCACGAATTCCATCAAACCGTCGTTGGCACCTGTCGCCAAGA
TACGGTACGGAGTTAGCTTCAAATCCAAGTTCACCTTTTTTAACAAACGATCCATCAGAATAAACATTTGCATAATCAGTTGATCTTGACGAAGATCGTC
TCCGTTCTTCACCATGAACTTGTACATCGGCCCTTCCTTTTCGCGGTGCAAGAGACTGATCATGCGGGTCGGCAACGATTCGCGCATTATGTTGCCGTCA
GTTCCGCCAAACATCGGCTGACTTAGATTTGCTATGCTATGTCCTTCACCTTCTGCAATGTTCGTGCAGAGATGCTGGTCACTCGGCGGAATCACTGTTT
GGAACTGAATCACCGCCGGGTACATCGCACTTTTAAACATTTTCGCTGAAGAAGGAACAACTCCACTCAAATGAATACACGGATCCAAAGGCAACGAAAT
AATGGCCCCCCTAGGCCACGGGAACTGCTTCAAATACTGCCGCAGCTTCTCTTCTTTTTGGTCTTTCCTGCCTTTCTCTTCGCGAGCCTTGTTGTGGATC
GCCAAAATGTGGCTCATGAAATCGCGCTGGGCCATCAGCATGTCATATATCGGCTTCTTCTCCACGTCACGCTTCATTTGCGTGAGCATCTGATTCAGCA
CAATGTGAAAGACCTCGGAGTCCTTTGTTTGCTCTCCAGCCTCCACCTTCAAATACCAGTAAAAGTAGTTGGCCATTTGGAAATTCGTGCTTGAGCGCGC
AATAAGGAAACGAGCTAACGGACCAAGGCTGTCACCAGCCATGGGTCCGTCTGTACAACCCATTTCGTCTCCACTCAAAGCTCCACGAGAAGATGTGATG
GCAACGCCAGATTTTTCGTACCGCAAAGCCTGGACAAGCTGCAACAGGAAATCAAGAAGATCTTCATTCTTGGCTGTCGCGAGAGTAGAAACAGCGAAGT
GGCGCACGATCTCGTGCTTGAACTCTTTTTCACGGCCAAGCAGCTTGAGCGCGTCGGCAATATCGATTTCGCACCATTGAGATAACAGATCCGTAGCTTG
TTTTACCTCCAGTTCGTCTTTCCAATCAACAGACAGGAGAAATTTTACTACTGCCTTCTTGTTATCTGTCAAAGTGTAGCGGAATTTCCAAAGCAAGTCC
TTGTCTTCATTCTTTAAATTGTCCGTCGGCGTTGCTAGCAAAAGCTCGATGCGTGCCTTTTCGTCGCGACTGGGCTTAAGATTCGGATCAATTGAACCGC
GCAGAATGTCGCGTGCAAGCCGACGGTACTTGCGTTCGGCAGGGTTATCTTCAGTAAGGTCTGGATCCCACACATTAACAAGACTTGGCATCTCTCTGCT
TCCAGCAGGCGCTGCAGTCGTCGTCAGGTCGTATGACCCGCTGAGTGTATGAGGTTCATACGACCCAGCGGTAGATGGATTGTTTCCATGCTCATAGTTC
ATCCGTCTGGATCCCATGTCTGCGGTGTAGGACGACGTCAGATTGCGCTGCGAGTAGGGCTCCTCCTCGTATACGACGACATCTCCAAAGTACGGCATCT
CAAGCCACAACAAGGCGTCTTTACGGTACGAGCAGAAAGGTCCGAGGGCGTCTCTTCTCGTCGGTGGCTCGCTACCTCTTCGAATACGAGCTATTCGCCG
ATCTGTAACACTGTCCATCCATTCGTTGCGCGCAATCTCCTTGCGCTCATACTTCTCACGAAGCTTGTCGAGTCGGAAACACTCTTGTCTAACCCACTCT
TCATCGACTTCAGAAGGAGTTTTCGTGTCGGGAGACGAGTCTGCCTCGCGCCCTTCCCAGATTCGAAGACACTGCACACCGTCACGGAGTACGCCCTGCT
TGGTAAAGAAAGAGATGGTAGAGCCGCCAATGGGGACCCACCCCACACTCCAGATCGTCATGGCCAGAAGAGAGTTGCGCGATAGGTCACGATAGCGCAC
AGGAAAGGAAATCCATTCATTCCAGTAGATCGTGGAGTTGCTGCATTTGGTGGGGCTCTTAGAGCTGCAAAGACGTCAACGGACAGTACCCCTCAACGTT
AACCTACAACGTACTCTACTTTGATCAAGACAGAAGCAGCACATACCTCACAACCATAGGATGCAACGGGAGACCATCAGAAAAGACCTGCGCCGTCAAG
AAGATCTCGCCAATGGACGAGTTGCGTACATCCGACGACGAGCCTGCGAGCTGCTCCAGTCCTGCGAGAGGCGTCTCGGCCGAAGCACGCTTAGGTGCAT
CGCTACTGACGGAACATCCCAGAGCGGGTGCCAGTTCTACCAATGAGATCTTGATGGAGATGCCCGTGCTCACACCGCTGCTGAGGTAGTAGCGGTACTC
CTTCA