Description :
From Genome Similarity Track
Location :
contig_47:373746- 374812
Transcript NameFunction/comments
g7895.t1hypothetical protein

Sequence
1066 bases(100 bases per row)
CGAATGTCTGTGAAACGATCGACAGACAAACGGTCTCGGCACTCAGATGGTTCAGAACCTCTTCCGCAAGATCTTTCTTGAAGGCGCCTTGAAACAGGTC
ATAGCGCAGAATATCTTCCGGTGCTACTTTAAACATTGACTGTTGATCATTGAACATGGTTAGATAACACTTCTAGTATGCAGCGTTTCGACAACATGGA
ACGCACCTGCATGATTTCACCCAGCTCTTCACACCTCTCAACAGCGCTGTCCTCTTCCTGGAAGCGGAACGAAATATCGGCCAGCGCTGCAAGCTCATCA
AACACCCACTCCGGACAGCCGTTTACTCGAAGCATGTGCAGATATTCGAAGACTGCGTGGACGATTTCCTCCCAGTGGGAAATACCCTCCAATGTGAGCT
TCATGGTAATATCAAACTTTGCAGCGTAGGTACCGCTATCGTAGCCGTCCGTGTCTGTCACTCCAGCAGTCACTGCAGAAATCCACCCGCGCTCCTTCAG
CTGGAATACACGCCGCAATTTAATAATGAATATCGCCCCCGATTTCATGAGGGAAGAACGTAGACTGACGTACATGTGACAGCACAGATCCTTCACTCTC
ATGGCCCAGCAGACTAGCGATATAGTCCGCGGGTTTCTGATGGTGCTGGCCAAGAACCGGTGGGATCATCCAGTCCAGATGCAGGGTATGAATATCCCGA
ACCGGCACAATCTTGCAGAGGAAAGATGAGCCAGAACCCTTCGCTCCAAAAGGCGAACCTGCCGACGCAAAAGACGGCACCGTGACCTGCTTGTGCGGGA
TCGCACTGAACGAGTTTCACCCACTGCTCGAGTTCATCCAGAGCGTTTTCACCGCATACAACGAGCTTCATGATGTTCGCTGAGTAGTACTTTTCATAAA
ACTGCAAGATTTGCTCGCGGACGTCCACGCCCGTCTTCTCCGGCAGCTCCAGCAGACTCTTCTTGTTTCCCCAACTAAATCGGTGATATGGGTGGCTAGC
GGGCGACACGTCACACAACACTTGCTGCAGCAGAGACACAGCAAAGCCCATCAGCACAAACTACCT