Description :
From Genome Similarity Track
Location :
scaffold_43:37373- 49142
Transcript NameFunction/comments
Pl_111301hypothetical protein PHYSODRAFT_343916
Pl_111302hypothetical protein PHYSODRAFT_476538
Pl_111303hypothetical protein PHYSODRAFT_552380
Pl_111304hypothetical protein PHYSODRAFT_284317
Pl_111305conserved hypothetical protein
Pl_111306hypothetical protein PHYSODRAFT_475220

Sequence
11769 bases(100 bases per row)
CGGGGGCATCCTTGCCTCGTTCTCCATTGCTCTGTGCAGCATGTTTGAGCGCCTACCTCCGGATTCAATTCCCGAATCGCAGCTTCTTGAGGTAATGGAT
GCGATACTTGCTATCATGGATCATCCATTCGCCCTCGGTGACTTGACTCGGGCTCGCAACGCCGTTGGTTTTGTGTTGCGCTATGGACTAAATGGATGCC
TAACAGAACGTCAGCAAGAGGTTCTTCTGGGGGGATATTTACAAAGGCTAAAAGATGAGACTCAGGTATTAGACCCAAACCACCACAAGATATTGTCAGT
ATTAGTGGAGATGAGTCACATGTTCCACTCGATGGGCGAAGCTTCTGTAACTCATGCTCGTGACGCTAGCGATATACTCCAAGGGCTTCTTTGCCACGAA
AAACAAAGTGTCCGCTTTCAGGCTGCTATCGCACTGGCTTCACTTGTCACTGCAATCCCGTACCGACTTAAAAACGTGCTGACGGAGTGCATTCAGGGCC
TCCGGGATACTGCTGAATACCTGATGCGCGGAGGTTCTGATGTCGAAGAAGCGAGAAGTTCAGAATCAGCTGGGAAGACGGATGATGGTCAAGATGAGAG
CAGTGATATACAAAGCAAGTCCCACCTGTATGCGATTCAAGGTAGATCCGCGGCAATTGCCCATATCCTTCGCGCAATCAAACTTGACGCTAAAGGAGGG
TTATCTCAAACAATTATGGATGAGGTATATACCATTTCGGAGGAACTTGTCGAGAGTCAGTTCCTCAATGAATGTGCAGACAGCATTTGGCTCACCTGTA
CGCGCGCTGGTTGGACGCTGGTTGGAAGTCTCGTGTCTATGAACAACGAACAGTGGATAAAATCCAATTTGGAGAAACTCCTGAATTTATGGCTCAAGTC
CAGTGTTCTACACAGTCGCGAATCCTCTCTTGAGCTGCTGCGTATTGAAGCTGCTGTAATTGCTCTGAGCAGTTTTCTATCCACCTACCAGGATTTCGCT
GTGGAATCCGATAATGATGTCAACCTCCTTGCGAGCCATGTATTGCATGTGTACTTGACGGCGACTCAGGACATACTCAGTAATCCTCTCAAGCGTCGCG
GCCAAATTGCTCGGTATCGTCTTATGGGGTGGATCATCAACTGCTTCACGATGCTTCCACCGATTTACAGTGATTCGTATATCGTTCTTTTGGATTTGAT
TGCCGAATTTACCACTGCCCAAGCACTGACAAGTCTCCGACATTCCTCACTAGTACCGGCGAAATCCACGTACTTGCAAAGCGTGCTTTCTTCGGAGGAT
AACACACTTGACGTGGTAACTCTTGCACGATTAGAACCAGGGGACTACCCTTCCCCGCTGTATTCAAGGGAACTGAATCACATCCTTGGTTTGCAGCAAC
GAGAAAACGCGTTGACAGATACTGAACTCGAGGTTCAATATCAAGACACGTTTTGGAGATCAATTGCTGAAAAAGAAGCTGTGGATGGTGTAACCAAACG
GGCTAGCTTCAGCCCGTTTACTTACGTTCGACTCGTTGACACAAGTGTGCTGTTGTTCGGTCGACTTTTTCACTTTATTCCGGAAGATCTACAGTTGCGA
TGCCTTCAGCACTACGCAGGAGCCCTAAGCGACGTTCGGGCGGACTGTGAAGTCAATGTGTGCTCGTTGTTATTTGCTGTGATTGCAGAAGCGAGACGTC
TCGAAAAAGCTGGAACCGCGCCAACTTCATCGGCGTCGCTTTCTGCAACATCTTGGCCTCTTCAAATGCAAGCTATGTTGTGTGAAATGATTTCGAGTGA
AAACTCTGGAGTCCGTCGTGGTGCCGGTGAGGCATTAGGATCATTAGCACTAATTCTAGGGGAAGATCATTGCAAGGGTCTAATTATCGAGCTGGAAAAA
CGTCTGGTTGTGGATAAGCTACCACAGGGAGTTTCTAACGCCACATTCGGACCCAACGCTGACCTGGATGTATCTATTCTGTCAGCTGGTGCAGCGTTTG
CGTTAGCCTGTATCAAGCGTGTTTGCGGCTCACGAATCTCCATTGACACAGGCCTCATTTTCCGGTTTGCTGGTGAGTGTTCTCAACCTCTGCGCACATG
GATCTTACATGCATGGAGTATTATTTTGGAATCCGTCAACTCAACAGGAGGCGACTACGAGCAGTTTGTTAACTCAACGTTTTCTCTTATGGAGGCCCAT
ATGCTAGCAGGCTTTGTCTATTCAAAGGTCAACAAACGCGGATTACGGTGGCAAATTAGTACAAAAGTGGCTCTGGGGAGAATTATTAACGATGTGGTGG
CAACTCTAGGTCCAGAGCTTGGTGGTTCAAGTGACCGTTTGAATGAGTTTTACTCTTACTGGATGCTTCTTCGCCAGGATGGCGATGCTCGTGTCGAGTT
GGAGTTCTTGAGGTTCCTGGAACAAGTGGTTGTTTTCGCGCCTTCTCGCTTTCAATCAACAGATCTGAGATACATTTTGCGCATTGTATCAGATACTGCG
CTGTTGAACGCTGCAATTTCATCATCAATAGCGCCACAACCGAATGCTGGATCTCCAATTTTATCGCCACCGTCAGGTCCTGGTCCGTCGCTAGTGACAT
TGGGGATCATTAGTGAACCATTCGAGGCTAATGGTCTCGTAAATGTTGGAGTCTATACAAATGGGTGGAGTCGAAGTATCCTACAGAATGTCGGCCTGTC
TTGTATTCGAACGCTTGTAGAAAGAGATCCGTCCTTAATTCGTCGTCAGAACCTGTTTTGCCTTCTGTTCTCGGCACTCCACGTTGAGTACAACGAACTT
ACATGGGGTTATTTACCAGGACTTCATGGCATGTGGGACGTGGTTTCCTTTGCTATTGCTGATTCTACTACCATGCATCGGAACAGTGTAAGTGCGCTGC
AGAGTACAGCACTGGCGTTACTGGACATCGAAGGAGGAGACCACGATGGCGCCGAACCGTGCCTCTGGGCTCTGTTGTGTCGTAGTATTGCCATTGGTGA
ATCAGCTAGTTCCTTTGCCGGGGCTAATGCCGAACAGCTGATGATGAGTCCGAAAGGAATGAACTCTGGTATTCAGGCAGCAGCAAATATTGAGAGTTCA
GTTGATGATGAAGCAGCATCGTGGTCACCAAACCCAGCTCTGGAGATACCTAAGTCTGATGCAAACTCACTTGCATCGGCTGCTGTTGCCGCTCAAGTGG
ATAAGTGGCGAGCTACAAAGTCAAGCGTGGGCGACCTCATAGCGTTTATGCCTCCGCTTTCACGGCAAGTGCGACACTTCGCAGTGGAATGTGTCTTGCG
TGTGTTTGAACTGATGGCAACAATCCCACCCATGACGACTGGGGTGTGCCAGACGAAGCAACTCCATTTTGATCTTGTGGCAGCCCGGCGCTTTTTCTTC
GAGATACTCTCTGCTGGTGCAGCGTTGCCAGTGTCCGTCGGTTCAAACATCGGGAATTTCTTGTGTATGTATCTGGATGAGTTTGTTACACTTGCGTGTC
ACGTCGCAACGACTTCAGCTGAAGGAGATGAGCTTCTTATGTTCCAGTGTGTGGGGCTTCGCCTATTAAATGTGTTGGTGAAAAACTTTGCGTCTGCACG
TGATCCAGAAGTTGCCGCGGGAGATGCTTATTTGTTGGACCCGTATCGTGCCCAGCTTTCGTCTGCTCTCCGGCATGCTTTGAAACAGGTACAAGTGGAG
TCTTCGCCGTTAGCGCCCAGTTTGGAAAAAGACAAAAGTGAAGAACGTTTCTTTTACGCACCACTGCTTCTTGAGGCACATGGCATTGCTGGAGTGTGCG
TATCTGCTCACCTCATTCAAGATAAGGTGGGATTGGGACGCATTCTGAGAGCAGTTTTGACTCCAGACTATGGGCACGCGCATTTCATTGGCGACGAACT
TACCCGCACTTCACTTTCGCTGGCTAACTTGGCGTGTGTGGGAGAATTGTTAACTTCATGTGTCACAGAGGCGATCACTCAAAAGGATGCGCGCGATGAC
GAACGTCGAGCTGTCGCCACATCTCCGCTTGTGAAGGCGATGACTAATGGCTTGTCGGAAACCACGGAGTACTTGTTCAAGTGCTGGATGGATATGACGT
TTGCGTACGGCGTTGTAATGCAAGGTTCTGCGCAGTGGGCACAATTGGACACAGCTACAAGCTCAGCGTTACTGGCTGACGAGATAATGATTATGCCAGC
ATTGCAAATGGCACTTCCACCAATCGGGGCTGCCGCGAACGATCCAGCGGCTGCTTTATCGACCTCAAAATCGCTACGTGCGTTATACAAGCGGTACTGG
CCCAAGATCGTCAACGCGATGGCAATAATGGAGGTTTACATGCCAAAGTCGGTTTCTTTCTTCAACAACATGCCGGAGGGCAATACTCCGAAATGGTCGT
CCGTGCTGTTGTCCAGTGCGATCTTCCATGTCAATGCGAATGCTCGTGATCGAATGGAAGACGAAGAGGAGCTACCAGCCGTTCTTCGTAGCATTCCATT
GCTCCTGAGAGCTTTAGTGGAGAATCCGCTTAACCAAGGTAGCTCTTCATCCAGCAATTTCCCCGTCCTTTTGACTACTGCGTTGCATACGTTCATGCTT
GCAAGTAAGCGATGTTCAGGACCTGCTCAAATTGAGGCCCTCGCAGCGATGTTTTCGTGCTTATCGCGTGAAAATCTAGCATTCTCTCGAGAGGCGTGCA
GCTCTGAGGAGGACGGTGAGGAGCGCTGTGCCATACTTTTCGAGACCGTAGCCCAAGCGGGACTATGCCCAACAGAGGTCGTTTGCCAACTTTGTGATGC
AACCGAGCAGACTCGACATGCTCGAGCAGTGAGCATTGGTAGCAGAACCACTGGCTCCCGTCGCAGTTCCGTTGCAAGTGTCGAGGATACGAAGCATATG
AGTGAAATCGTGCAGTTTGCTACAACTGGTATTGTGCTCCTACACACAACCGAAGAAGCGCGATGTGGGGTGGTGCGATCGGTGGCTTTGGTGCAGCAAG
CAATTTGTTCTGTTGCTGGTGGCTATCATTCGTCCGTAGTAAAAGATGCTGTGGTGACGCTTAGTCGTGCTTCCACAGAGTCAGTGCTTGCGCTTGCACG
CACGCTTGAAGGAAGGAATGATTCGCATGATGATGTTTTAAAACGGATCTGCTCAAGTGTGCAAAGTTCCTTCGAGTTCCTCTCTGAATGGCTCAAGGTA
GACATTCACACTGCTCCAGGTTTTTCGATGCAGATCGTGGCAAACTATGCTGTGAGTTTCCCGGCATGTCTCCAAGACGACGCGGAACGCTTCCATGCTG
ATGTGGTAGAAACGACCACAGCAGTGTTGGAGATTGCGTCTGAAAACGAAGACGACGACGTTTTGAGGCTGCAGCATACTGCAGTTCGTGCAGAGCTTCT
GCGAGGTTTGCTCGTAGTTGTGAAGAAGCTCGTCGATGTGCGTCAGACCTCCATTTTGAATCGGTATTTGGTGGTGATTGGTCCTACTCTCGTAGAGATT
GTTGGAGCATCAAACGGTTACCCTGAGACAACAGCGGCACTTGCTGAACTCGATGAAGCGGAGGGGCTACTTCGCCTGCTGACGGCGCAGTTAGATGACC
AGCACGGTTCCACGTTAGTACACATGGTGCTCCCGAGGCTTGCAGCAGTACTCAGCCATCCTACACCGTCAGCTGTAGACAACGCTATCCCCGCACAAGT
TTCTGGTATTCTGGCGCGGTTATTGCTATGCTTTGCACAGACTCACGCTTCTGCGTTTAAGGAAGCCGTAGCGGCCATGACCCCCACACTACGTAGTGTG
CTGGAAACTGCGCTGCGTCTTGCTCTCACAGGTTCAGCTCCAACTGCTGGATCACGCGCAAAATCGTCGATCCCTCAAGCCAGTGGTCCTGTTGGTGTCA
AACTTGACCTCAGTCGATACAGCTAAGATGTAATGTTTGAATGTGAAATACATATATTCGTTCGTAATTGCTACGTGCGCTGAAGAGCATCATTGACTGG
TTTGCGCGTGGGTTTGAAAATGTTGTAAGTCTCGATGCTGGATCGGTGGTCTTCGACAATAGATAATACTCAGAGCGTCATCTCCGGGCGCGAAGTAGTG
ACAACATCCTGCACAGCCAGTAGCTCCAGCAGGCTGAATAGAACTGAGTGCACAATGTCCATGCTGTAGAGCTAAAGAAAACAGTCAAGTTAGATTAGAT
CTTGCGTTCGATAGACCACTCACCTCTAAGCCTCCGTCTAGGTCAATGGCCACTTCCTGCATCTCGACACGCTCGATCTCGAATGTAGACAAATCAAATG
GTAAGGCGTCAACGTACAAACTCTCCGTTAACTCGATGAGCTCTAAACAACATGACACATCAGCAATCCTCATCACAAAGCAGTCATTAATCTATCTAAG
CTTACCTGGTACGTAAGTGGATGAGCGATTGCCTCCAGGTCCGTCTTTCGTCTGTTGGTATAGTCGACGCAGCGTAGACCAGGGCACCGTGAGTGTGTAT
GTGCGCACAACATCCTCTTCTTTCGTCGCACGGTATTTCAGCAGCAGCGGCGCTCGTGGTGGTTCTTGTGCAGCGATGGAACTTCCTCGAGTGTATTCTC
CTTCATCTTCTTGATTATTCTCTTCCCGAATTCTTGTCGATCTTCTTGTCGATCTTGCTTTTTCAGTCAACAAACTGGCCATCACCCAGTTGCGCGCTAA
GCGCTTGAGATTCAACTGCTGAATGTGCACAACATGAGTACTCACTACGCATTGAAAGCGACGTTGCAGCCACGAACAGACCCAACGCAGCAGTTCTTCG
TCTCCTCTCAATAACAACACCTGCTGTTTCTCGCGTCCTTTACGCGGTGCTCGTTGCTCCTGTTCTGTTGGGAAGTAGAGTACAAATCCTCCTGAGCGTT
CTGGGCCTTCCCTACTTGGCTTGGATTCTCTACTACGACGTCGATCACGCTCCTCTCGGATCTGGAAGGCCACGAACGTGTCCGTATTGCGGATACTCAC
ACTGTATCCAAACTGCTGGCCACACGCCCGTAGCGCCGCCGCACGCAGCGTTTTGACCAGATCGTGTGCATACTCGCTGAGCTGGTCGCGGTGAAAGTGG
AAGAGCGGCGATGCGCAGTGGAAAACCCAACGGCGGTCTAGCAGCACCTGTTCCATGCTCACGCGCTCGCGCTCCCGACGTGCTGCGGCTTCGCGAGGTG
TCTCTGTCTCTTTCTTGACGCTGTCGACGTCCTCAGGTCCGCGCGTATACTGCGACGGCCGCATGGGCGAGTTGTAGGCCTCTCGGAGCTTCTGCTGCTG
CGCCGGCGTGATCCTGACGGGCGGCTCCGGACGCGAGTTCTCCATGGGCGACTCGACTTCTGGGCTGCTGCGACAGCAAATTGTCATCAGATCGTAACGG
TTTATGCAAGTCGGAACAGACGCTGATTGGTAAAATCTGGTGAAATTTTGACTGAGCCCAAAGCTGACGTCTGGGTGCGAGACCTCCTGAATGACTCGAC
TACCACATGCAGCTTAACCGCCAGCTAGAAGCAGGAAGATGAGGACCACTACGAGCACCAGGATGATGATGTACAGTTTGGTGTTGTTGCTTTGCTTGGC
CACCTACACGATAGCGTTAGCACGACAACTAGACAAGAAAAAACAGAGTTTCATCATCGTACCCGCGCCGCACGTGCACCTTCGGACTCGAGTCCGTCCG
TGACACGAGACACATCGTCGTCAATCTCATTCAGCAGGCGAACGTGCAGGTCCGTCTCATCCTTGACAGTCAAACTGTAGGTGCGCAGGTTGGAGACGCC
CTGACCGATTAAGTCCAGCTGTTGGTCTTGGTCCTTCATGATCTGGTTCTGCATGCTCAGCAGCCTCGCCGGCGCATCCGCTGCCCCAGGACTGTGAAAC
ACGTAGTATTAGTATAACTGCAACCAATGGAGCTTCAGGTCGACGCACCTCACTGCAGCCCGCGACGTCTTCCGGCTGTTATACATATCCAAGTCCTCTT
GCTGCCATTAATCTCGTTAGGTCGACGGTCCCGTATCACAAGAAGGTTAAAAGACTATATACCTGGTCTCGTGCAAGTTGGTCCAGCAGCCGCTCGCGCC
GCTCAATCTCCTGCTTCGTCCTGTATATCGGCAATAGATCTGGTCAATGAGACGCCAACGAATGTCCAAATAATTGCGTCGTACACGGAGCTGGACGATC
GTTTGAGCTGATCGAAGTCGCGCTTGAGTCGCGCCACGCTCTGCTGCAGCGCGAAGACACTGGTGCCGATGGCGCTTGAGTTGCCCGTACGGATCTTACT
GGACAGCACCTGCTCCTGGCCGCGCGCGCTCTCCAGTCGGTCCAACCACGACGCCCATGCCGTCGCACTCATGAGTATTAGAGAATTCTGATTCTCTTCG
AAAAATCTTTAGTGTCTGATTCGTATTCGAATCAGATTCAGAAGGAATCAGATGCAGGCGATTGGCGCTTGAGGCATTAGGAGATCACCATGAGCCAGCG
AGAGTTCGAGCGCAAGATGGAGGAGCACATCGAGGAGATGCGCGTGACGCAGACCATCGCATTCTTCAGTCGCACGGTGGAGTTGTGCTTCACGGACTGC
GTGCACGCCTTCCGCAGCAAGAAACTGGACGACAAGGAGACGTCGTGCGTCAACAACTGCGCGGAGAAGCTTCTGCGCCACACGATGCGATCGTCTGTGC
GTCTACAGGAGAGTTATGCTGAGATCATGCAGCAGCAACAGGAGCAGCAGAAATAGAGCGACCAAGTAGAACAGCCAAGAGCACAAGATGGTTGCCCCAG
TAAGGAAGATTCAACAACGCTCGCAGACTTCAGGTCTGCTTTTGTATCGATCTTGGCCATGATTGTAGCATCTACCTAGCTAGTAATGGCCCTGTACACA
GCAGCTAACGGTGATGCAGTTCCAGACAGGAACTTCCAGCAGCACGCTAAACGTGACGCAGTCCCCCGCTTTAACGACATGTCATTGCAATCCGCCCATT
TCAAATCCCATTTCGCCTATTCCTCCCAAAAAATGGCGCCATCCCCAACAAATGCAGAGGAGACTTCGATCCGCGGGTACTCAAAGCGTGGCGATGGGTT
CTCTGTGCAGGAGACGGAAGGGCTGTTACAAGAAGTGCGAGAGCGCTGGCAGGAAGGATGGGACGTTATCGCAGAGATGCACAACGCGCAGTTCCCAGGC
CACAAACGCACTGCCGGCTCGCTCAAGCGCAAGTTCGCCAAGCTCTACCGCATGAAAATCGACTCGAACACCAAGGAAAAACACGCACGCGCCTCCGTCT
TGGCCAAGAAGGTGCGCGAGGAGATGCGCGGCCAGCGACGTGGCCTCCCTAGCGCCGCGCGCGTGCTTGGGGACGACCTCGTAGCTGAGGCTGACGGTGT
GGAAGTCCACGAAGACCTGAATGAAGTGATGATCACGTCCCAATCAGGCACACAACATCAAACGCTAGCTGAAGCTACAGTGACGGCTAGTGAACACGAT
TTGCGGCAGACGCTGAGTCAGAGTGTGCCAATGACGCAGGAGACGCCGCTGAGAGAGGATGCGTGGCAGGCGGCTATTAATCGTTGGCCTGTTGCAAGCG
AACCGCTGCGTAGATTGCGGTCACAGATGGAGAGTAGCTCGACGACGTCCAGTCAGGACTTGATGCAGACTGTGCTGCTTGTGCTGCTGGAGTCGCAGCA
TCAACGCGACTTGGAGCGGGATCAGGATCGAGAAGAACGTCGACTGGAGAGACAACGCTGGCAAGATGAAATGCGGGAGCAGAGACGTCGACATGAGCAG
GATCGTGCTGAGGACCGACGCAGGAATGAACAGTTCATGCAAGTGATGACCACGCTGGTGGCGCAGATTGCTGCTGGTCAGCAGCAGCGAAGCGGATTGA
ATTGAGCGATGATGAGTGGAAGGATTTGCATACGTCATTCTGACAAGTTTGTTGTCATCTGGTGTGCTGCACGACATTGATAATAATAGTGGATGTGCTC
TTGTCAAGCCCTCGTTGGTACCAGTACAGTAAGTTTTAGCTCTCCAATGTTACATGATCCACCTCGCATCCTATCCCAATCTACCATGTCCGCCACAGAA
TAATCAGGTTAAGGCAACTTTTGCTTTGCGAATGCTGCAAACACTGTTCACTGCTGTTGCTACGAACCTCTCGCATCTATCCACTCAGGGAGACAACGTG
GTAGAACACAATTTCAAAGTCGGAAGAAAAGTGTCGAATTTGAATTGTACCTGAAAGTCTTTCGCTGTAACAGCAACCGCCTGATACTCGGCCTTGGTTC
GAGGATACAGCTTACTTTGACGCAACGTCTGTGAAGCTTGGTGATACCGCAGTCGCCACTTTCACTCTGCAAATGGGCGATATCCGTTGGATTTTCAATA
AGAAAACAAACAGGTAACAATGGCGAGTCGAGGGTGTGGTGCTAACCTCATTGATAATTGTTTCGAGCTCGATACAACGGCGAGTGCGTTTGCGCAGACG
CCATACCTATTGAAAACAACTCCCGAGCTTCACAGCTGCTCCAGCGTTCCAGCTATTGCAGCCTGTAACGAACGAACATGAGGTGGACGTCAGTACGATT
ACGGAATTGAAATTCCGCCCAGCAATCGCTCAACAGTCCGCATCTCGCTCCTGGACGGCGCTATTCTTGCCCACAAGCAGCATCATCATCTGCATGAACT
GTTCGTGTCTGCGTCGGTTCTCCTCGCGCTCTTCAGCGCGTTCTTCATTGCGACGACGTCGCGTTTCACGCTCTTCATCACGTCGACGGTCTTCTTCCTG
TCTCCTTTGTTCTTCCTCTTCTCTACGACGTTGCCTCTCCTCTTCGCGACGTTGTCTCTCCTCTTCTCTGTCCAAGTCTCGTTGGTACTGCGAGCGCAGA
ATGACCTTGAGCACAGACGTCAGCAGATCATCGGTCGGCAACGGTGTCGCCTCTGGCGGGAACACGGCTGCTGCACTCTGCCACTCAGTCTGTCGTGGCA
CCCGCGCACGGGGACGCAAAGCCGCAGGAGGTGGCGTCGCAACTTGTGCTGTAGGAGACGTAGTGAGCGTCGTAGCCATCGCAGTAGGCGGCACCTCGGA
CGCCGTGTCCACCCAGCTGTGTTCCGACTCAGTAGCTCCATCCTGTGCGTGCTCTTCGCCCTGTGGCGGCTGGAACGACGCATCGCTGGTCTCCACTGCT
GCATCTCCGTCGACCGTCGATAAGACAGCTCCTGGAGCGGGCGGCACGCCCTCAATCATCTCTTTATGGACGACATGAGCGAACGTAATGGCCTGATGGT
TCTTGGCGCCGCGCGGCGGGATATTCGCGCGATACAGACGTGAAAACTTCTTCTTGAGCGAGTCGGCCGAGCGGTTGTGCTTGGCGAACTGCTGGTTGTG
CATCTGCGCAATGACGTCCCAGCCCTCGCGCCAGCGACTGCGCACCAGCTGCAGCAATCCCATGGATTCGGCCTCTGTGAAGCCGTCGCCGCGACGCTGC
ACATGCGGCCCAAGTCGCCGCTTTACCTCCGTCTCCATGACGTCCTGCGGAGAAAAGCGTGCAGCCATTTTGTGGAGATTGGGGGATGCAAAGAAGAATT
TGCGAGTGAATGGGTGGATCAAAATTTTGCGCTGAACTGGAGGCGATCATTCCAGAACACTGGACTGGGTTAGAGTATGCTTGGACCAATATACAAAATC
CAAATCGATTTGGGCGCGAAAAGGCCCGCCCAGAATTTGAATTTGTGGACCTTGAAGTTACTGACGTCA