Description :
From Genome Similarity Track
Location :
Scaffold_14:373671- 381756
Transcript NameFunction/comments
Physo_131082hypothetical protein
Physo_131083hypothetical protein
Physo_131084hypothetical protein
Physo_131085hypothetical protein

Sequence
8085 bases(100 bases per row)
CAGCGCCATGACGGCCTTAGTGGAGCCCATGCGCAGGAACGTGGCCTGCTTGAGGCTGTGCATGAAGTGCGACTCGACGCTCTGCTCGTTGTCGCAGGGC
AGCAGCACGTCGCTCGGGAAGCCCCAGAAGTGCACGGTCAGTGCCCACGGCAGGTTGAGGGCTCCGTCGGCTCCAGGTCCGCACAGGAGGTCGCGCAGCA
AGCCGAAGGGCAGATGCCAATGCAGCGGCACCCCCTTGGCCTCGAACCAGATGGAGGCGCCCTGCATGGCCGACATGGGCGGCGCCGCGTCGCGGAAGTA
CTCGACGACGTCGCGCGTCTGGGAGACGAGGTAGCTCATGCGGGGGACCATGGCCTACAGAGGGTAGAGCAGGTAGAGCAGGAGGATATACTTCAGTGCA
TGCAGTGACTTGGGGGGCAAAGGTAGAAGCAGCGGCGCCTCACGTAGAACGATCGGGGGGCGTGCAGCGTGGTCACTTCATTCGGGTCCAGAGAGAACAC
GACGGGGATGCGGCCGGCCCACACGCGCTGCTTCAGCGGAACCTCGGGGGCGGCGCCGGTCGAAGGTGTCGACATCGGTGAGATTTTTTGCCGCGATGCA
GCCGAAACCCCGTTTTTGGTATACAGATCGAGTCAGGTTTGGCCTACAGATATGGCATTAGACTAGCGATTTGTATTTTTTGTCGAAAGGAGGATGCAGA
TCAAAGATTTTGAGCGGTCTCAGCCCCGGTTGTGCGAGCGCACACGACGTCGCCGCGTCAAACCGCATGAAGTTTTGTGCTTTGCAGCGGCTGCTACACT
GTTACTGCTATGCTGATTAACGTCTACATGTGGACGTCGCATTATTGTGGCCTCCATTGGCAAATTGGATTGGACTCGTCTGGTGCTTTACAAGTTTCGT
GAGCGCCACGCTATGGGCGAAAACTCAGCTCCGAGTTGACCTGGTCACGAAGGACCGTCAGCGCACTGTGAACTTCACACTGTGAAGCTCACAGCAAGCC
TCCCTCGGCTCTCTAGCAAAGAGTTCAGGCTATAACATTGGCGTACCCAAGATTATCGTGGGCAGATCCGGATTGGTGAGGTGGGCCATTTTCACAGACA
TGCGGAGTTGGGGCTATCCAGTCAAAGTGTCGAAGAATCCCTGAAGAAATCTACAAATTGAGTCGCAAGTCAGGCTGCCACGGCAACGAAGGCCCATGTA
TGATACCTAATAATAATGGATTAAGTTCGTAACTTATTCGCTCGTTTCGAATCGAAGGTGCACTTTTGACGATCAATTCTGAAGTACGAACTACGCAGCA
AAACTTCGAGAAGATGACGAACTCAACCCGGTCTTGGAACGCTGTTTGAACCACATAGCGTTCACAAACGGTGTCTGCAAAATTACCCTCCCAAATCTGA
CAATAACCCCGAATAAAATGGTGCTTGTGAAGCAGTCGACGACATCTTACAATCCACGTCTGCCGTCAAGCACATCTTCCGGATCGGTCTTTCGCTTGAT
CGCTGTCCACCAAGTTCGAGACACTCATGAGCGCCAGAGTCCAATCGTACGCCATTTCCAAACCCTCCGAAGTCAAGCTAGCATCGCGAATTAATTCGAC
GCTCGCTATGGTCTCTCTACTGAACATCGCTGTCGTTGCAGCCGTCTCCAGCGTCGCCGCGGGAACTGCGGACGCAAGGAAGCTCTCTAGCGGCGTGTGC
TACGCCCCGTGGCACCACCCGACCGTCAACTGGGATGTCCTCGCTGGCGACATGAACCAGGTCTCCCAGCACTTCTCCAGCATCCGCACGTACCAAGCTC
AATTCAACGGAGTGAACGCCATCAGCATGGCGGCAGCAGCCGGCCTTCACATTGCGGTGGGCGTGCAGCTTACGGACCCTCGCTGGATCGACGCCGAGAT
CCAGGCAGTCTGCGATGGCTACGCCAAGAACGCGTGGGCGGTCGAAGCCGTCTACGTGGGCAACGAGGACCTCAAGAACGGCAACTTCGGCACGTACTCG
GCCGACCAGATCGCTGGCTACATCCGTCGGGTCAAACAGTGCGTGGGTAACACTCCGGTCGGCTCGGCCCAGCGCATCAACGAGTGGCTAGGTGCCGACA
GCGCCTGGGCCTTGGCGAACGCTTGCGATGTTATCGGTGTCAACATCCACCCGTTCTTCACGCCGGGCTCGCAGCCTGCCGTGAAGAAGCTGGAGGCGCA
GTGGAACCAGATGACGTCCAAGTTTGGCTCGGCCAAGGTCCGCCTCACGGAGACTGGCTGGCCGTACGCTGGTTCGTCCTATGCCGGCAACGTCCCGTCG
ACTGGCGCCATGACGCAGTTCTTCTACGACTACGTCTACGGATGGTGCCCCGGCAAGAGCCAGTCGTACTGGTTCATGATGTACGACACGACCGTGAGCT
ACTCTGGCGCCGACTACGAGAAGCACTTCGGTCTCTTCGGCACGGACAAGTCGCAGCACATTAGCCTGCCGTGATTCGAATACACTGGGGCCTATTCTTT
TAAACAAATGAATAGATTTTTTCGAAGTTTACATTATGTTTTGACTTTCATCCTTTTCACCTCCAAAGCTCTCAAAAATACTGAACAACATCGCACAGTG
AAAAAGCTCGGGGCGTTAGCTAACACTTTGTCGCTTAGATCGTTGACACCTGTGCGACTGTAAACGAGTCACGCTGCGTTTGCACACGCCACCAAGTAAC
CCGAACAGCTGGCGTAAAGTTGTCTGCGGACAGCAAAGCACGCACGCGATCCATCCAGGCCAACCATGGCGTTCGAATCCCTCCGACTCGGAGCTCAAAG
GGCCAGCCACAACGATCGTCTCATTCTAAAAACATCCTTGTACCGCGCAAGACATCGGCACTCCAAGTCAAGCTAGCAGCGATGGTATCTTCACTGACCG
CGACCGTTTTCACCGTTGCCGCTGCGTTCGCCGCCGGTTCCCCTGAGGCTCGTCAGCTATCCACGGGAGTGTGCTACGCGCCGTGGCATCACCCGTACGT
CAACTGGGACGTCCTGGCCAAGGACATGGCGCAGGTCTCGCAGCACTTCTCCAGCATCCGCACGTACGAGTCTCGATTCAGCGGATTCAACGTCGTCGAC
GTGGCTGCAGCTGCGAACCTCCACGTCGCGGTCGGCGTGCAACTCGGCAACCCGCAGATCATCGACGCGGAGATTCAGGCGGTTTGCGACGGCTACGCGC
GCAACCCGTGGGCTGTCGAGGCCGTCTACGTCGGTAACGAGAACCTCCAGAACGGCGGCTTTGGCTCGTACTCGGCCGAGCAACTTGCCGGTTACATTCG
TCGAGTTAAAAGCTGCGTGGGCAACACGCCGGTGGGTTCCGCCCAGCGTATCAACGAGTGGCTTGGAGCTCCTGGCGCGTGGACACTCGCGAACTCCTGC
GACATCATCGGGGTGAACATCTACCCGTTCTTCACGCCTGGATCGCAGTCGTCTCTGAAGAAGCTGGAGACTCAGTGGGACCAAATGGTGTCCAAGTTCG
GCCCGAACAAGCTGCACCTGACCGAGACGGGCTACCCGTACGCTGGTGAGACGTACTCTGGCAACGTTCCTTCGATTGGTGCGATGACGCAGTACTTCTG
GGACTACGTGTACGGGTTTGCAGGCGGCAAGGGCCAGTCGTACTGGTTCATGATGTACGATCAGACGGTGAGCTACTCCGGCGCGGAGTACGAGAAGCAC
TTTGGCCTCTTCGGCACAGATATGCCGCAGCACATTAGCCTGCCCTAAACAGTCAGGAGTGAAACAAGAGACCAAAGTTTTGAAAGCATGTTGGCGTGAA
ATATCAAAATTGACGCGTGCTTTTACTTCGAAGTAATAACGAAGTTGCCGGAGTTAATAATTAGCCGTGAACACCACTACAGTATCCACATTTTGTCCAC
ACTGATGTTTGTTGGAGTACATGTAGCTCGTGAAGGAGTTGGAAGGGGAGGGGACAAGATTATGGTGACGCTGGCTTACGAGGCTGGTGATGCAGCAACG
AGATTACGGGTCATACTTACGGAGGATTTCTTGGAGGATTCCGGGGCGAGGACAATCTGACTGTACATCGGGGCCAAGGACATTCCAAGAAGAAGAAAAA
AAACACGCAAGATTTCAAGTTAACCAAAAAAAAGTAAAAGTAAAGCGTCTTTGTTTCGAATTTGACCACGTAATACTCTATGTGAAAGAGAACAACTGTC
AAAATTTCACCCCTCCAAAATACTCTACTTACTTAGAAGTACGTCGGACATATACCATGAACGAAGAAATGATAATGTCGAAATAGAGAGAAAGATATCG
TATACTGCGCTTAATACAAGATACAGTCTGTAGCTTACGAAGTAGTTCTGACGCTTCTGGCCTTCCACTGAAAGTTTGGGGAGATCAACGCCTTCTCAAA
CACCATCGACACATCGGCCAGACTTCCGAGCAGACCCAGCAGAGGCGTCAACATGTCACTCTGCGCAATGATGCTCGACACATACCCACTGTGCGCATCG
AACTCAAAGTACACGGAGCCTTTCATCGAGATGCGTCGGCCGACCAGTTTACTCGCCAACGTGTGAGTGCTCAGGTGCGGGAACAACTTCTGCAGCGTCT
GCTCTGTGATTGTCAGCGTGGTCCTGGTGGCGGTAGTCAGCGAGTTGTCCGAGATCTTCTCCAGGCCTCTGAGATCGACATCCACGTCGTCGAACCACTG
CAAGAACCACCAGCTCCTGATCGCGGTCGCTCGGCCAAACCCGTCGTTGCACGCAACATCGGCCGCCATCGCTTTCTGCACGAAGTCGAGCTGGGCGTCC
GCTTGTGCTTGTGCTGGAGGAGCATCGGGTGACGTTTGTCCTTTCAGCTGGAGACCACGACGGAAGAGCCACAAGTACTCGACGGCCACGTTCCACATGT
TGGCCTTCTTTTGGATCGCTGCGGAGATATCGTTGCGATTTTCTTCAAGTTGGGCGACCTCGGCGCGAAGCTGAACGGTGGACGTCTCGAGATCCGCGAG
CTTGCCGTTCTGCTTCTTCCTGTATCGCCGTTGGCTCTCGCGGTACCGCTTGCGGTGGATATCCTGGCCCAGACGGATCAGCTCTGCAATCCGCGCTTGG
TTGACGTCGGCCTTCACGGCTGCAAGGCTCGCTGGGGAGGCATCGTCGCTCATCTGGTGCCGCTTCGGGTTGGGGCTGGCAGTGCTCGTTGCTTCCTCTC
TCTGTCTCTTGCTCGCTAGCGCCGCTGCTTTCTCTGCTGGAGCTGTCGCGTTGGCCCCACTCGTGCTGTAGTAGTGCACGTCGGTGTTCCATTGCCACGG
GTTTGCGGGGGCTACATGCGCAGCACCGCCGTGTGCGGACGGAGTTGGGCGGCGACCGTTCTGTAGTCTGCTGTAGCCATAGCCGACAGTGCTGTCTGTT
CTTTCGTCGCGGTAGAAGTCCTGACCACGCTTGGGGTGCTTCGTGACGGCAGATATGACGCTGTCGCTCATAAGATGATGGTTCGGGGGGCACAGGATAC
TGGTGTTCATAGTTGTATGAGCCTTGGCTGTTGCTTCCTTGGCCGTTGAATGAGCTATGACACTTAAGCTGCAGCCAACAGAACACTGTAGCGTGGTGCT
TACTGGGAGGGATGCTGTATTTCACGGTACATTTAGCATAACCGGTCTCGACACTGTGAATCTGTATACCGCCGCCTCTACTGAAAATAGATGCAGTTCA
CTCCAGATCCCTAGGTTGGTTTAGTCACGGTGAAAATGGTGACGGCACGGCGCACAGTGAACACGCGAGGTTCCACCAAGCATCTGTCGTTCCCGCGAGG
TCAACGACACACGAATTTGTTGGCGGAGACGAGTGGCCAACAGCCGGCAGCGTGGTGTACAGCGAAAATTTGCGCACGCACCGTGTGTATAGCTTCTAGG
GCTAAAGCGTTCATCCACAAAATTGTTGGAACGCGTCTTCTTCAGTAGCAGTTCAGAATGGTACAGGCTAATCCATGCTCCACTAGAGCTTTACCGCGAT
AGGAATTCTTGGACATCATGCTGCTCAACTTGCAAGTACAGTCAATTACCTCAGTGTTCGCACCACTTTTTTCTAATAACCCGTTAATTCGGATCAATGA
CACAGGGATTATCAGTCAATATCTGTTTATTATTATTATTGTGCTTTGCAATGATTTTGGCAATATGAGGCGAGATTTGCTGTATTGCTGTATTTATAGC
GACCACCTGCTATATTTACGATAAATCGAGGTGCATAAACGGGTGGAGGCCTAGAATTAAGCTAAAAGCGCCACAATTGCACTTTTGAAAGTGCAATTGT
GGCTGTGCAGTCGCAATTCTGTCGGTTTTTATCCACAAGCACCTACACACACGGCAATTATGCATGAGAGGGTAGATGCGCTGGGGATCATGGACGGTGG
TGTACTGGGCCAATGCATGGCTGCTGACAGGCCCTCCCACGTCGATATATAAATGAGGAGGTGGATTTATGCATAATTTTAGCAGGTCGTGTATCTTCTT
TCACACATATTTAGGAGCAGGCTTTGCCATATTTAACGTCTAAAATGCTCGGCAAAATTACTGCAAAGCACAATAAATACTAATTATTTTGCAAATCGGT
TGAACCATCGGGGTTATACTGTACGATAGATCAAAATGGCACACTACCATTGATGACGGTCCAGCGTCAAGTAATTCAGACTGCATCTTCTTGCATGGCA
TTAGGCGAAAGTGCTGTTGACGGCGCGACATCACGTAATATTGGCTCTGCTCTCAATCCTGTGCTTCGAACAGCATTCGGTATTGCTCTTTTTCTTCTTC
AATGTCGATTTTCCGTGATCTCACCCGTTCTCCCCATTTTTGACTTGCGGATTTGTACTGCTGAAGAGTTTTCTTGCCTTGTCCTGCCCCAGTAGCGCGA
GAGACGTGCATCCGGCTGTTTCTTCTGAATGAACCACGAGTTGAACAACGCGCTCTCCAATTTCTTGGCTATGCCTCTGGAACTCCTTGTATCCTTACCC
AACACGATCATTATTGCCAGATTTCTCTCGCCGAAAACGTTCGTGAGCGCTGTGACCATTGCACCATTTGGATCCTGCTTGTGCACCAGGGTGGCGTACA
AGTTTTGAAATTGGTGCTTGCAAGCAACTCACGACCAGCTTCGATTCGATGAAGCCATTCTTGCCAATTGGCATCGTGCTCAGCTTCAACGTCTTGAAGG
CGTTACCGATAGATTCACCCGTCTTGAGAAGCCCCTCCAGCTCTTTGGTCTTGCTTGACTTGAGCACGCTTGAAATCTTCTCCAGGCCGGGAATCTTTGC
AGAAATACCCCTCTCTTCGTCCTCATAAGCTCTTAGAAGTCTCTTGGTGGGGGTATTGCTATCGAGTGTGTGGGTCAGGGTGGCTGATGTCTTCAGCTGG
GATTCGCCGGTTGCTGCGGCGATTCCAAGAAGCACAGCAGAACGACTACGTGGCGGAACCTCATGACAGGACTTTGGGAAGTTTACCTGGGTTGGGCACG
GTGTAGGAAGAGAGGTAAATTGGAAAGTGGGGCGTTCTGCATGGAGCAATGGGAAGGATCCTATGGCGCCACAAGCAGCTGCTAAAGCAGTCTGTGTGGA
TGCGCAGTTTGTCAAACTTAGACAAAGACAAGATAAAAAAGCGAAGCTGGCAGGATCCACGTGGAAAGCACGAGCCCGAAGAGATCTTGAGATCAGTTTG
GCGATCGTATACAGATGACGGGGCCAAGTTGCGTAACTCGCCTCTTTCTGGCTCGTGGAATTGTTGACGGAGTGAGGTCGAGTAATGTGCTTTGCCTTGA
AGAAGACCATCTGGCTTCGCACGGCGAAGTAAACCTTTCAAGTCTTAAACGCAGTAACTATAGATCTGCGATGCAGGTGGCATTAATTACCTATATCCGG
GGTGCGTCAGGTTAGGACTTTAGTCCTAAGTCCTATAGTCCTAAGTCCTATTGTGATCACCACGCATTTTGCCTATTTCCAATGCTAAATCGACCGAGAT
TAGGAGATTTATGCTCTAGATACCCCGAATTATTATATATATACCTCGCCTCACTCCTTAATACCCCGAGCATGTTCGGCACCCT