Description :
From Genome Similarity Track
Location :
Scaffold_1436:3736- 6894
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1436-fgenesh-gene-0.0Conserved gene of unknown function
Pytir_DAOMBR486maker-pir_contig_1436-snap-gene-0.3Glycosyl hydrolases family 31 protein

Sequence
3158 bases(100 bases per row)
ACCAACGTGCGCTTCATCGGCGTGTCCAAGAAGGAGTCCCACTGCGTGTACATGGTCCACGTGGACACGGGCGCCGAGCAGTTTGTTGTCCAGAAGCGCT
ACTCGCAGTTCCGGGACTTTCGCGCGGAGCTCTTCGCGACGCTCCAGCAGGCGCGTCACTGCGGCAACGGACCTTGCAAGCAGCTTCTGCAGCTCACACA
GATCAAGTTTCCGCGCCGCAAGCTGCTCGCGACGTGGCGAAAAGACGCCGACCTGATCGTCGCGCGCGAGCGACTGCTGCTGCTGCAGCGCTTTGTTGAA
GCTATGCTGCACGTATACCGCATGGCCCCCAAGCGCCAGCTGCGCTGCTGCGTCAACATCAAGTGCCCGGCGATGGAGGCGATCCGAGGTTTCCTGCAGA
TCACGGCGAGATCGGATGCTGAAGAGAGCGTGCGCGCGTCGTCCGCGTCTGTGGATCTTGTAGCCCCCATGCGTGACTCGGAGCTTGTCCGAGTGCAAAG
CAGCAGCCCCGAGCGAGACAGTATCGAGAAGTCGTCCTCATTCTCCGAGCAGTCGAGCCGGCGCCAGGCGCGCGGCTTCCCGCCCCCGACACGCGCCTCC
TTGTCGGCGACGACGGACGTGGACCACCAGTTCGAGCAGCTCTACACGATCACCGAAGACACGGAGCTCGTGCACCTGCACGCCTAGAAAGCTGAGACTC
GATGGAAAGTGTCAGTCGGCTATACGAGCAACAACACGTCGATCATCTGATCTCCCTATTTTATAACTTATGGTGGCGGATGCAAAGTCAAAAATTACAT
AGAACCACCACCACCGCCACCACCACCTCCAAGCCAATTCGACCAGCCCGACAAACCAACAGAGTTCCAGCCCAACCAGCTGTATCTTCAGAATACAAAT
CGATGTGTGTAGTGCATCCACCAGCAAGTGTAAATATGAGTATGTACAGTAATAACGAAGCCCCCACACAAATCAAACTGGTCGCTCTCCAAGTCTCTCA
TTGTTATTGATTAGCTTCATTTATTTCATGTCTTCCGCACGCGAGAAGAGTGAGACAATGGCCGACGTGACTTTGTCGGACGCGTCGTCCTGGAGCCCAC
CGAGGATCTTAGACGTCTTGCTCCACTGGATGTTGCTCTTGATCACCTTCTTGTCCGTCTCATACAAATGAGATAATATCGTGAATATGAGCTCCTGTAC
ATCGTGTGTATCAACCATGTACGCTTCTGTACCTGGTCGTTGGGTGGATCGATGCGCTGGCCGTCCTGGTCCGTCACGATCTCGTTCGCGCGAGCTTTCG
CCCACTGTGTCATGTTAAAACAAAAAGGTTAGCAACGCACTGTAGAGCATGGGATATCAGCAGCAGCAACAGCCACTAATTACTGAACAAACCTCGAGCC
ACTTCTTGTCGTGCACAGGCCGCTGCGGTTCCGTCGGATTCGTCACGAGGATGCTCGGGCGTCGGTTGTACACATTCTTCGTCGTGCGTGGGGTCAGAGG
CGATGGTGGACTTCTGTTGCTGAACCACGGACTACTACTGCTACTAAGACTGCTGTTACTATTATTGCCAGCACCTCCTGGACTTGTTGGTAGCACTGGC
AGCGGACGGCGCACTGTCCGTATATGCGAATCTACGCCAGGTGAGCGCGGTCCGAAGCCCGTGAGGTGGTGGTCCTGCTCGTGCTTGGCCAGGATCGAGC
TCGCGAGCTTGCGCTTGTACATGGTCCAGTTGGCGTCCACTTGGAGGTCCTGCTGGACGTTCTCCTCGTCGATGCGCATCGTAAGCTCCAGGGCCTCGGC
CCGCAGCAGCGTCTCGGTAAGCGGATCCTTGAGCGCGCACTGACGGAAGTCGACGCGGTCGATGCGGTAGAGGATCGCGTTGGGCGACGACACGAGGACG
GAGAATACGGCGTTCGGCTCGCTCTGCATGACCTCGTAGGAGCCAAAATAGTGGCGGCTGCCGACTGTGCAGATTTCGATAAAGCTCATTCCGATATTGG
GGTTACTGCTGGTGTCGCGAGGGTGCGGCTTCGTCTTCCTTTTCGAGAGCTGGAAGCGCTTGACGAGACGACACTCGCCGTGCTTGACAAAGTAAAAGTT
GTCTACAGACATAGTAATGCCGATCCCATACCAATCAGTACCTAGTCACATAGTCGATGGCTTAGTATGTAGGACATACTTGCAAGTTCGCCCTCGGCGA
TGACGATGTCGTTATAGGAGAACGTCACTTTCTCCATGCGCCCGCAGAGCTTGAGTGTGCAGTCCGTGTCCCAGTGGTCGAAGCCCCTCGCACTCGATAG
AAACTTCACTTTCTCTCTGCAATAGTAGTAGTATCACAGTCACACACCCAATTAGCTGGTTCCTGCCACCAGAGAGTGACGCATAAACCATGGTAAACCT
CAAGACTTACCGGAGTTCTCGTCCAACGTTGCTGCTCCGGAGCTCCAGAAACGTCTCCTTGTCGATCTTCATCAGCAAAGTGCGCTCGCACGCGAGGACC
GACGCCGTGCGGTGTTGGTCGGTCAGGAGCAAGCCCACGTCCCCAAAGCACTCGAGCGCCTTCAGCGTGCGCACGACGTAGTTCGCGTCCTGCGAAATGT
CTAGAGCAGAGAATAAGTATAATCACATGTTAGACAAACTGTAATTAACGTACTATGGACAAGCCGCACTTCATAATAGCAAAATCCAACCATGACCCGC
GATCCCTCCAGGGTTCGAAAGGCTCGAGTGCACGCGCGCACGGTTGAGGATCTCTTCAAACTCGTTCAAAGTCGGCGCCGCCATGTGCGCAAAGTCCATC
ACGACGTTGAGCGAGCCGTACATGACGCAGTAGAACGCGTCAGCGGCATCGCCGATGTTGAAAAGCGCCTCGCCCACGTCGATCTCAATGCCTTTGACGG
CTTTCAGGTATCGGAGCCGCTCTTTCGGAGGCACGTCCGAAAAGTAGTTGACCGAGTGGACTGTGAGAGATCGTGAGGTAGTATGTCAGTAGAGTCCATA
CGCTGTAAGCTTACGTCATATAGCTAGATAGATATACAGGGACCCATTACCGTATTTGTCGAGGAATTCATAGTCCGTCTTGCATCGAGCAACGTCAGAA
GTGAGCAGGATACGCTTCAGCGTGGCGCGCACCTCGGCCGTCGGGTTGTCCCCATCGA