Description :
From Genome Similarity Track
Location :
contig_10:373584- 375358
Transcript NameFunction/comments
g3333.t1hypothetical protein
g3334.t1hypothetical protein

Sequence
1774 bases(100 bases per row)
GCGTCGTCGCCGCAGTTAGAAAGCGCGTTTGTTGGGTCCTGGCGCGAAGCTGGAGACGCGTTTGTGCATAGCGGGTAGCGAATGCCCTTGGTAACAGTGT
TCCCCGATTGGTCTGTAGAGTTTAGATGTTGGTGTCAAGCCTGAGAAGACAAATGAAATGGTGAAGAACAGAGGTTTTTGCCAGGTGTCGGTGCTGTGAA
GTCTCCACGGCATGCTCGTTAGACGACAGCATCGGCGGAAAACACGTCAACGTCCATTTATGAATTCGTTCCGACGGTCTCATGACCGACTCTACCACGA
AACCTTGCTGCTTTACATGCCTCCGAGCGCTGTTCGGTCGAAGACTACAATACGCTATACACACAAAGGCGCCCTAAAACGCTAAGAAACTATCGTGGCG
TCTAGTTGCGGCGGCGGCGACGAACGCTGCACTTGTCGCTAGTCTGGCTGGCGCCGGTCTCCGGGGCTGAAGTGACCACAGGCGAGTCCGTGGCGGGGGC
CTCAGTGGTGGCCGGGGCATCCGTAGCAGGTGACGAAGGGGTAGCTGGAGCATCCGTAGCAGGGGACGAAGGGGCATCCGTAGCAGGGGATGCAGGGGAA
GAGGGGGCCTCAGTGACCGTCGGTGCGTCCGTAGCAGCCGAAGCAGCCGAGGCATCGGTAGTCTGCTCACTAGACGAAGAGTCGGTAGCGGGCGTGGTCG
AGTTCGAGGTGCCGCCGCCACCGCCACCGCCGCCCACGGCGAACTTGGATGTAGCGCCCGAGGAGGTAGTCTTCTCAAGAGCGGCGCAGTTGATGTACAC
CTGCCACGAGGCCGAGTGCAGCGCAATCCAGTAGATGGACAAACCCGACGAGCCGAGGCACGCGTCGCGGTCATAGGGCAACTTGGCCGGGGCGGTGGGG
AAGTTCTTGGGGCAGTTGTCGTCCTGGAACACACGGGTGTCGTCACACCACACCTCGCACGGGCCCTCGTGCGAGGCCGTGAAACCCTCACCGTCGCCGT
GGCTCCACTCAACGTACGTCTTGGGCACCGGCTGTGCGGCCTCGTCCGGGTTGGTGTAGCCGCACTCCTTGGTGAATTCCTTGTTCACAAGGACCAACTT
GTCGGCCATGAACTCCTTCAGCGACGAGTATTTGCTGGCAGCAAAGCCCTTGTTAAAGTTGGCCGTGTTGTCGGTCGGAGAGCCGCCAAAGGTGCCGGTG
AAACCCGAAGTGCTGGAGTCGATCGTCCCCATGTACTGCGTCGTGTCACCGACGAAGGTGAACTCCACCTTCGGCACCGACATGGAGCCGTGGCCCTGCA
CGGTAGCAGAGAGCATGGCCGAGCCCACGATCGCCGCGAAGGAAGCTTTTCCGAGAACCATCTTTGAAAACCTGTTTGCTGTCTGAAGCTGCTGAAGGCG
AGAGAGGTGTGTTGCCGTGAGCGAAATGCAAAATGGTTGATTGTGGGGCATTCGCTGTCCGAGCATTGGGCACTTATTCCGATCCAGATTACAAAAGAGG
CTCTGCAGAGTCTGCACGGGCATTAAAATCGAGCTGGGCGAATCGAGGCAATCATGGGATCTGCTTGACACCCGTGCTTAAGGGCAGATGGAACGATGGG
GATCGCACCCTTCAGATTTGAGGCTGGCCTTATGCCACTGATACCTACACACAGGACTCAACGCCGCAATCCGCTTCAACCAAGTGAAGACCTCTAAATA
CTAGTAATCCACCCCAAAGCGAGAATATCACTTGAAGATGCCATTTTAACACGGTACACAAACAATTTCTACTA