Description :
From Genome Similarity Track
Location :
Scaffold_444:37358- 38825
Sequence
1467 bases(100 bases per row)
CCACGGCGAGAAGTGCCGGAACACGTGGGTGGCGAGGATTGTTCACTAAGAACGGCGTCATACCCGTCGAGGAGTGCTCGGCGTTGTTGAGTGCGAACTC
GGCTAGCGGTAGGAACGAGCTCCAGCTCGTGTACGAAGTCGCATAGCTGCGGAGAACGTCTTCAAGGACTCGGCTGACGCGTTCTGTTTGTCCATTTGTC
TCCGGATGTGCCGCAGTCGACATCAGCAATTTGATTCCTAAGAGCTCGAAAAGGCGTGACCAGAATGCGGATGTAAACCGCGGGTCGCGGTCGGACACGA
TAGACTCCGGCAGACCGTGATGACGAAAAATCACGTCGACGAAGTGGGTTGCGGACTCTTCCGCGGTGATTGAGGCTGCCGCCGGAACGAGATGGACCAT
CTTGCTGAAACGATCGACAAACACAAGAACACCCGTCCGCCCGGCTGTATCGGGCGGAAGACCGAAGATGAAGTCCATCGAAATGGAGCGCCAAGCTTCC
GTGGTGACCGGAAGAGGGCGCAATGGAGCCTGGGACGTCGGAGACGGTTTGACTCGCTGGCAAGTTTCACATGTACGGACCCACTTGCGTACCCACTTGT
ACATGTGTGGTCGATAGAAGTCTCGCGACAGAGCCGCGTACGTCTTCTCGCGACCGAGATGTCCTCCAGTGGGGGCGTCATGATACTCGTGGATTATGCG
CGCACGTAGATCAGCTTCGTTTGGGACGACGACTCGAGGTCCATCGAACCTGTCGATGTTGTACTTGAGCTGATTGCCGTCCAGTCGATATCGATCAATC
TGATTACACGTGGTCCTCGACAGGGCACTTAGCGTGTCACTACTAGGAGCACGCAGGTGCTTCACGATGGCACCATATATAGGGTCATCATCGTACGCTG
TAGCAATCTCGTCGCCCGGCGGGAGCGTGGCCGTGGTCAACGTCAATTTGATGCCTGACGACACGCAGACCGCACATTCGTCGTCGTCCTCATCAGCCAG
CTGATGTCCTAGTGCTTCACGGGGATCGTAGTCCGGACGCCGAGACAGCGCGTCGGCGAGAATGTTATTCTTGCCCGGCTTGTAGTGAACAACGAAGCTG
TACTCGGAGAAGAAGGACAGCCCAACGGTTCATCCGTTGCGAAAAGTGAGGCTCTTCATCGCTGTCCGCAGCGATGCGTGATCAGTGTAAACCGCAAATG
ACTGTTCACCGAGCAAGTACACTCTGAATTTGATCATAGCGTACCGCATTGCCAGGAGCTCCTTGTCGTGGACTGGGTAATTCTTCTCGGCTGGCTTCAG
TTGGCGCGACTGATAGCTGATAACGCGCTCGTGTTCGTCATCATCGAACTGCATCAGCGCACACCGATGGCAAAATCGCTCGCGTCGCAGAGACGTGGAA
ATGGCTTTGAGTCATCAGCAAGCTTCAGGATCGGCGCAGACGCCTAGCTCTTCTTCACCGAGTCGAA