Description :
From Genome Similarity Track
Location :
Scaffold_163:37346- 38796
Transcript NameFunction/comments
Physo_144037hypothetical protein
Physo_144038Avh_248
Physo_159204PsAvh248

Sequence
1450 bases(100 bases per row)
CTGAACCAGTCGCGGTCCGCCATCGCCGGCACCAGCTCTCGTCGGTCACGCAGCTTGAGTGTCAACATCCGACGCAGATTCGCCATCCACGCGCGTCGCC
CCGCACTGTTTTCGTCTGCATCATCTCGTCAGTCCCCCAACTCTACGCAAAAATATTTTTTAATTCAGACGTAAAGTACCAGCCGCCTCCATCATGCCAC
TCAGCCACAGTCGCGCCTCCTCCAGCGCCGGAAACCCAATCGCGACCTGCGTGGGCCCATACTGCAGCTCGAAGTAGTAGTACCCGTTGGTCTGCGCGAT
CGAGGCAGCAAATGTCGCCTGAAAACAATAAAAAGATATAAAAATGTTAGCATAAAATCTCCAGGCACACACGAGACCAGGTCTCACCTTGACCAGGTCG
ATCTCCTTGGTCTTGCCCCTGTCACCAGTTGGTAAGTAAACAATAAAAAAAATCAAAATACTGCAAGCAGGTGCATAAAGTAAAGTAAAATGTTTTGAAT
TACTGTACCCATCCGATTTTTTCTTGTAGAGTAAAAAGCCCTCGGCCGTCACCACCGCCGCTCTGCACCACGAAAACGCATAAAAGAAAAGAAAGTGTAT
TAGAATTACCAGGTTCTGCCGCGGCCGGCAGCGCCCGAGGCTCACACACCGACTGTGCCAGGCGCGCAGGATGCCAGCGTTGCGCTTCCAGATGGTGCCG
CGGAGGCGCGGGGGAGCCGCGTCCGCCATGCTCCAGCACTGCCGCAGTAAAAGTGATGCGCCAGGAAAGGTGGCGTTATGCGGCGTGTGGCGTCGTAAAG
TCACCAAAAGCCGTGTTAGCGCAACATTCGAGCAACATAATATATATCAACCAATCGGCGTTCGCCTTGGTCGACAGCACAATGAAGTCGACTGTCGAGA
CCGGATGAAAATCGAGTTTTTGAGGTCGAAAGCTGCATTTTATGTTGTTTTCAGCGTGCATTCCAGTACCACGGCTACAGTGGTGTGTACTTCCAGCTTT
TGAAGAGCTCCAATCTACTTAATGCTGCTACAGTATTGGCCGCTGCGCTTATGCTACAGGTACAATCTTGAACTTGGCCTTCGCCTCCAGGTCGTTCCAG
GACTTCGTGTACGCGAACCACTGCGCCAAGCCGGGGTTGCTCTCCACCGCCGAGGCCGAGTTGGAGTTGAATTTGATTTTGGGGTCCAGGCCCTTGGCCA
GGAAGTACTCGTCGGGAAGGACCTTGAACTTGTACAGCACCTCGTCCGACACCTTGAGCTTGATGAGCATGGAGGCCTTGGCGACGCGGAGCTTCTGGTC
CAGCGTCTGCCCCTGCTTCGCCGCCGCCTGCACCAGCTTCGAGTTGGAGACCCACGTCCTGAGCTTCGTGGCCAGCTCCGGCAGGCCCCTCTCTTCGTCG
GCAGCGTCGAGCGTCTCCTCGAGGCCACGTAGTGACCGCTTGGTGGTGAT