Description :
From Genome Similarity Track
Location :
contig_10:373448- 375222
Transcript NameFunction/comments
g3505.t1hypothetical protein
g3506.t1POM71158.1 Hypothetical protein PHPALM_12309 [Phytophthora palmivora var. palmivora

Sequence
1774 bases(100 bases per row)
TGCGCCCGTTGCTACGACGGCCACTCCGACTGCCACGACAGCGACTGCTACGACTGCTACTACGACAGACGCGCCTGCTACCAGCACCGACACCACTAAG
TGCTCGGTGCGTCGTCGCCGCAGTTAGAAAGCGCGTTTGTCGGGTCCTGGCGCGAAGCTGGAGACGCGTTTGTGCATAGCGGGTAGCGAATGCCCTTGGT
AACAGTGTTCCCCGATTGGTCTGTAGAGTTTAGATGTTGGTGTCAAGCCTGAGAAGACAAATGAAATGGTGAAGAACAGAGGTTTTTGCCAGGTGTCGGT
GCTGTGAAGTCTCCACGGCATGCTCGTTAGACGACAGCATCGGCGGAAAACACGTCAACGTCCATTTATGAATTCGTTCCGACGGTCTCATGACCGACTC
TACCACGAAACCTTGCTGCTTTACATGCCTCCGAGCGCTGTTCGGTCGAAGACTACAATACGCTATACACACAAAGGCGCCCTAAAACGCTAAGAAACTA
TCGTGGCGTCTAGTTGCGGCGGCGGCGACGAACGCTGCACTTGTCGCTAGTCTGGCTGGCGCCGGTCTCCGGGGCTGAAGTGACCACAGGCGAGTCCGTG
GCGGGGGCCTCAGTGGTGGCCGGGGCATCCGTAGCAGGTGACGAAGGGGTAGCTGGAGCATCCGTAGCAGGGGACGAAGGGGCATCCGTAGCAGGGGATG
CAGGGGAAGAGGGGGCCTCAGTGACCGTCGGTGCGTCCGTAGCAGCCGAAGCAGCCGAGGCATCGGTAGTCTGCTCACTAGACGAAGAGTCGGTAGCGGG
CGTGGTCGAGTTCGAGGTGCCGCCGCCACCGCCACCGCCGCCCACGGCGAACTTGGATGTAGCGCCCGAGGAGGTAGTCTTCTCAAGAGCGGCGCAGTTG
ATGTACACCTGCCACGAGGCCGAGTGCAGCGCAATCCAGTAGATGGACAAACCCGACGAGCCGAGGCACGCGTCGCGGTCATAGGGCAACTTGGCCGGGG
CGGTGGGGAAGTTCTTGGGGCAGTTGTCGTCCTGGAACACACGGGTGTCGTCACACCACACCTCGCACGGGCCCTCGTGCGAGGCCGTGAAACCCTCACC
GTCGCCGTGGCTCCACTCAACGTACGTCTTGGGCACCGGCTGTGCGGCCTCGTCCGGGTTGGTGTAGCCGCACTCCTTGGTGAATTCCTTGTTCACAAGG
ACCAACTTGTCGGCCATGAACTCCTTCAGCGACGAGTATTTGCTGGCAGCAAAGCCCTTGTTAAAGTTGGCCGTGTTGTCGGTCGGAGAGCCGCCAAAGG
TGCCGGTGAAACCCGAAGTGCTGGAGTCGATCGTCCCCATGTACTGCGTCGTGTCACCGACGAAGGTGAACTCCACCTTCGGCACCGACATGGAGCCGTG
GCCCTGCACGGTAGCAGAGAGCATGGCCGAGCCCACGATCGCCGCGAAGGAAGCTTTTCCGAGAACCATCTTTGAAAACCTGTTTGCTGTCTGAAGCTGC
TGAAGGCGAGAGAGGTGTGTTGCCGTGAGCGAAATGCAAAATGGTTGATTGTGGGGCATTCGCTGTCCGAGCATTGGGCACTTATTCCGATCCAGATTAC
AAAAGAGGCTCTGCAGAGTCTGCACGGGCATTAAAATCGAGCTGGGCGAATCGAGGCAATCATGGGATCTGCTTGACACCCGTGCTTAAGGGCAGATGGA
ACGATGGGGATCGCACCCTTCAGATTTGAGGCTGGCCTTATGCCACTGATACCTACACACAGGACTCAACGCCG